Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Drug that demages capsule is used to treat viral infection because Curing a viral infection antibiotics are useless against viral infections. This is because viruses are so simple that they use their host cells to perform their activities for them. So antiviral drugs work differently to antibiotics, by interfering with the viral enzymes instead.
Antiviral drugs are currently only effective against a few viral diseases, such as influenza, herpes, hepatitis B and C and HIV – but research is ongoing. A naturally occurring protein, called interferon (which the body produces to help fight viral infections), can now be produced in the laboratory and is used to treat hepatitis C infections.
The answer is A
This is because 90% of energy is lost when we go up one trophic level. This means that even the the consumers tend to be larger in size, they are fewer in number and need to eat more in order to sustain themselves.
Answer:
Membrane transport is essential for cellular life. As cells proceed through their life cycle, a vast amount of exchange is necessary to maintain function.
Explanation:
Answer:
POPs are lipophilic, which means that they can be stored in fatty tissues for long periods of time.
Explanation: