1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Agata [3.3K]
2 years ago
6

A zygote (the cell formed when an egg and a sperm cell initially fuse) is:

Biology
1 answer:
Effectus [21]2 years ago
4 0

Answer: https://rb.gy/rb1nlh copy that into search browser

Explanation:

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
2 years ago
Why would a drug that damages capsules help treat a viral infection
ss7ja [257]

Drug that demages capsule is used to treat viral infection because Curing a viral infection  antibiotics are useless against viral infections. This is because viruses are so simple that they use their host cells to perform their activities for them. So antiviral drugs work differently to antibiotics, by interfering with the viral enzymes instead.  

Antiviral drugs are currently only effective against a few viral diseases, such as influenza, herpes, hepatitis B and C and HIV – but research is ongoing. A naturally occurring protein, called interferon (which the body produces to help fight viral infections), can now be produced in the laboratory and is used to treat hepatitis C infections.

4 0
3 years ago
Why are ecological pyramids shaped as pyramids?
REY [17]
The answer is A
This is because 90% of energy is lost when we go up one trophic level. This means that even the the consumers tend to be larger in size, they are fewer in number and need to eat more in order to sustain themselves.
5 0
3 years ago
Read 2 more answers
What is something you learned about movement across the membrane
emmainna [20.7K]

Answer:

Membrane transport is essential for cellular life. As cells proceed through their life cycle, a vast amount of exchange is necessary to maintain function.

Explanation:

5 0
2 years ago
According to the World Health Organization, persistent organic pollutants (POPs) are found in nearly all tested organism tissues
olga55 [171]

Answer:

POPs are lipophilic, which means that they can be stored in fatty tissues for long periods of time.

Explanation:

8 0
2 years ago
Other questions:
  • Which term describes an extensive network of tubes, sacs, and vesicles throughout a cell that provides transport as its main fun
    10·2 answers
  • 5 reasons why weathering and erosion are different
    8·1 answer
  • .
    6·1 answer
  • R-sected species give parental care and protect offspring. true or false?​
    15·1 answer
  • A chill is a sign that A) body temperature is falling. B) body temperature is rising. C) body temperature is not changing. D) th
    13·1 answer
  • anxiety is the actual experience of apprehension and uncontrolled arousal and ______ anxiety is a personality characteristic, wh
    13·1 answer
  • What term is used to describe a retrograde flow of urine from the urinary bladder into the ureters that is the cause of recurren
    9·2 answers
  • I don't what it wants me to answer, if you understand it please help​
    5·1 answer
  • Which of these is evidence of global warming?
    12·1 answer
  • In the electrolysis of aqueous nabr, which substance is first produced at the anode?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!