1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
crimeas [40]
3 years ago
8

will you plss give some tips how to write and make it presentable (and i don't want you to writ it for me just help me) 20 point

s!!

Biology
2 answers:
soldier1979 [14.2K]3 years ago
8 0
Here's a tip something I would do. I would first start off by writing my essay in order from the things they tell me to do. For example,the first thing they want you to do is know where volcanoes are located write about that first then do what they ask second.See that is a simple trick that I use.
Galina-37 [17]3 years ago
5 0
Make sure to have good grammar first of all. Since it's for kids try not to use too big of words or phrases that they might not understand. Other than that just write about what it's asking to do, for each question it suggests make a new paragraph too,  I hope this helped, good luck! 
You might be interested in
Dina is a paleoclimatologist. she wants to review documents to assess climate data for her hometown. which historical documents
lana66690 [7]

Newspaper articles and farmers harvest yield record are the documents should Dina examine in order to assess this climate data.

Among atmospheric scientists is a group known as paleoclimatologists. There were 11,800 workers in this field in 2014, albeit not all of them were climatologists or paleoclimatologists, according to BLS data. With 40% of the workforce, professional, scientific, and technical services was the main employer of atmospheric scientists.

<h3>What level of education is required to work as a paleoclimatologist?</h3>

Your future work as a paleoclimatologist will involve a lot of biology, physics, and other hard sciences, thus there are lots of degree programs that mix these fields with the environment. Environmental biology and environmental chemistry are two examples of such options.

<h3>How far into the past can paleoclimatology take us?</h3>

Paleoclimatology makes extensive use of polar ice sheets and ice caps as well as mountain glaciers. Data from ice-coring efforts in the ice caps of Greenland and Antarctica date back over 800,000 years in the case of the EPICA project, or several hundred thousand years.

<h3>Why is paleoclimatology essential and what does it entail?</h3>

Our knowledge of Earth's climate depends on the science of paleoclimatology. Scientists can create models to help predict how rising carbon dioxide levels and other changes can affect the climate of Earth in the future as they become more aware of how climates have been influenced in the past.

Learn more about Paleoclimatology:

brainly.com/question/14843418

#SPJ4

6 0
2 years ago
Which gases are found in the atmospheres of the gas glants?
irakobra [83]

Explanation:

Dioxide , Nitrogen, Oxygen, Sodium , Hydrogen , Helium

and others.

6 0
3 years ago
Help so easy with number 5
qaws [65]
The Answer is C. stratosphere
7 0
2 years ago
What is a food web?
Gnoma [55]
I believe the answer is (B)
<span>a complex series of feeding relationships with many organisms interacting and depending on each other </span>
5 0
3 years ago
Read 2 more answers
How are human waste and human population growth most likely to be related?
evablogger [386]
The more people the more waste that will be created so D
4 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Transcription activators are different from transcription factors in that A. transcription factors prevent RNA polymerase bindin
    14·1 answer
  • Chyme entering the large intestine normally consists of __________.
    10·2 answers
  • Why is it useful for scientists to divide the deep zone into three separate zones?
    12·1 answer
  • Which molecule provides the amino acids that are assembled during translation ?
    12·1 answer
  • ________ process by which carbon dioxide and other gases in the atmosphere
    13·1 answer
  • If you are in blood group B, what antibodies do you have in your plasma?
    6·1 answer
  • What do u mean by the term inflorescence ?<br>Thank you​
    13·1 answer
  • What is a feedback mechanism?
    9·1 answer
  • The list shows some of the livestock being raised in South Dakota.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!