1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jolli1 [7]
3 years ago
9

Multicellular plants and unicellular algae have one important feature in common. What is it? A) They contain chlorophyll. B) The

y reproduce by cell division. C) All are made of one or more cells. D) The cells of each contain exactly the same parts.
Biology
1 answer:
otez555 [7]3 years ago
7 0
A) they contain chlorophyll.
You might be interested in
How does cloning work and work are the basics​
Musya8 [376]

Answer:

How cloning works: In reproductive cloning, researchers remove a mature somatic cell, such as a skin cell, from an animal that they wish to copy. They then transfer the DNA of the donor animal's somatic cell into an egg cell, or oocyte, that has had its own DNA-containing nucleus removed. ... This young animal is referred to as a clone.  

Basics of cloning:

Isolation of target DNA fragments (often referred to as inserts)

Ligation of inserts into an appropriate cloning vector, creating recombinant molecules (e.g., plasmids)

Transformation of recombinant plasmids into bacteria or other suitable host for propagation.

Screening/selection of hosts containing the intended recombinant plasmid .

Explanation:

4 0
3 years ago
DNA. Is a process in which the DNA in the chromosomes is copied
ludmilkaskok [199]
Dna is a code sdasdasdasddsddsds


3 0
3 years ago
At Happy Harry’s Laundromat, the dryer costs $1.50 for 10 minutes. At Jolly Judy’s Laundromat the dryer costs $2.25 for 15 minut
g100num [7]
They are equal I think
8 0
3 years ago
Which statement is true about biodiversity?
never [62]

Answer:

related with genes, microbes

5 0
3 years ago
How do amounts of green pigment,chlorophyll, different from summer to fall
ohaa [14]
In summer, the amount of green pigment and chlorophyll are much more, in fall, the amount of chlorophyll and green pigment is less. That's the reason the leaves turn colors.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which description of Alexander Hamilton is correct? A. a former British captain who turned a disorderly group of American recrui
    8·2 answers
  • Do plants break down glucose to obtain energy?
    9·1 answer
  • Sophie says dolphins and sharks look very similar, so they must be related. Jake disagrees, saying DNA evidence has shown that d
    15·2 answers
  • Why is water so susceptible to pollution?
    6·2 answers
  • Which set of characteristics best describes igneous rock? A) largest type of rock, made of organic matter, hardest type of rock
    13·2 answers
  • What are the three things that a plant needs to make its own food matter? What happens when a plant does not get these things? *
    7·2 answers
  • Which of the following statements about the cell cycle is correct? *
    10·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Why are the rhizobium bacteria beneficial to plants?
    7·2 answers
  • Whats the answer ugh
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!