Answer:
Complex II
Explanation:
The electron transport chain refers to a group of electron transporters embedded in the inner mitochondrial membrane that transfer electrons from electron donors to electron acceptors which undergo redox (reduction and oxidation) reactions. The energy released during the transfer of electrons is coupled to the transfer of protons (H+) from the mitochondrial matrix into the intermembrane space, generating an electrochemical gradient that is then used to synthesize ATP. Complex I and Complex II are membrane-bound complexes that act as mitochondrial redox carriers. Complex I is a proton pump that uses energy from the electron transfer chain to pump protons, while Complex II sends H+ onto Complex III in the form of the reduced ubiquinol. Complex I receives electrons from NADH and transfers them to ubiquinone, while Complex II directly receives the redox cofactor FADH2 that does not pass through Complex I.
No, it is not a reasonable gamble for Karen to skip the influenza vaccine this year.
There are many factors which can increase a person's risk of developing the influenza virus and some of these factors are age, health condition, weakened immune system, pregnancy, or chronic illnesses.
Karen is older and her age could act as a risk factor for influenza. In addition, each year there are different strains of the virus since the virus is constantly changing and evolving. Given this, a person who got the vaccine last year is still in danger of not having the antibodies which can protect from this year's strain.
Karen should get the influenza vaccine this year as well.
Heterotrophs are a type of consumer, where they eat other organisms.
They obtain organic food molecules by eating other organisms.
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
D. <span>a cell that has one complete set of chromosomes</span>
