1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Temka [501]
3 years ago
9

Who first recognized the cell as the universal unit of life​

Biology
2 answers:
nydimaria [60]3 years ago
5 0

Answer: Virchow van Leeuwenhoek

Explanation:

Over [174]3 years ago
3 0
Robert Hooke recognize the cell as the universal unit of life
You might be interested in
A food preservation method in which microorganisms metabolize components of a food is called
Firdavs [7]
<span>A food preservation method in which microorganisms metabolize components of a food is called </span>fermentation.
When the food is going on fermentation, there are good bacteria over there that will inhibit other bacteria to grow on that food. Fermentation also able to made the pH more acid, making the area is not suitable for bacterial growth.
8 0
3 years ago
Which of the following is not a characteristic of life?
valentinak56 [21]

Answer:

Change their external environment is the correct answer.

6 0
2 years ago
How do desert plants conserve the water available in their body?
Sveta_85 [38]
Well for starters, they do not have leaves which reduces transpiration. They also grow really long roots that can absorb the smallest traces of moisture in the earth.
7 0
3 years ago
Describe how birds, butterflies and spiders benefit from members of the angiosperm.
Naddik [55]
<span>Birds, butterflies and spiders benefit from members of the angiosperm because angiosperms provided them with food.</span>
5 0
3 years ago
Which kind of drug impedes the nervous system by causing neurons to fire more slowly?
tia_tia [17]

Answer:

A. Depressants

Explanation:

6 0
3 years ago
Other questions:
  • Compare the recipes of nutrient agar and macconkey agar. if an organism can grow on both media on which would you expect it to g
    14·1 answer
  • Can someone help me in this multiple choice question ;)
    15·2 answers
  • A 54-year-old woman with a history of osteoporosis has been prescribed ciprofloxacin for recurrent cystitis. because of the pati
    5·2 answers
  • Based on the formula for kinetic energy, how will the temperature change if you increase the average velocity of the molecules i
    6·2 answers
  • Fill in the missing atoms or groups in the skeletal structure below so that it is a monounsaturated fatty acid with 10 carbons t
    9·1 answer
  • From the following, choose the factors that may produce or increase the risk of mutations.
    6·1 answer
  • Identify the terms described by selecting the correct word from the drop down menu
    11·1 answer
  • The mother is heterozygous for type A blood and the father is heterozygous for type blood B. Use alphabets to answer the questio
    6·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • How would a shift in land use from forest to agriculture affect atmospheric carbon dioxide?.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!