1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
antoniya [11.8K]
3 years ago
12

Do venus fly traps have to be in direct sun light or shade

Biology
2 answers:
Irina18 [472]3 years ago
7 0
You want them in the sun. but at the same time not to much sun. 50/50
TEA [102]3 years ago
4 0
The Venus Fly trap requires a lot of sun to grow healthy and create the energy it needs through photosynthesis. The preferred conditions are to keep it in an area where it will get direct sunlight. If indoors I would recommend placing it by a window or under a heat lamp.

I hope this helps!
You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
In the protein synthesis STEM case, which of the following mutations/errors created
g100num [7]

Answer:

B. Premature stop codon mutation

Explanation:

5 0
3 years ago
How does photosynthesis contribute to the organism’s energy needs
Molodets [167]

Answer:

Through photosynthesis, certain organisms convert solar energy (sunlight) into chemical energy, which is then used to build carbohydrate molecules. The energy used to hold these molecules together is released when an organism breaks down food. Cells then use this energy to perform work, such as cellular respiration.

Explanation:

5 0
2 years ago
Choose the correct answer​
-Dominant- [34]

number 2

number 2 because the colour doesnt matter

3 0
2 years ago
A larva develops through cell differentiation from
BabaBlast [244]
The answer is egg! I really hope this helps you out!
8 0
4 years ago
Read 2 more answers
Other questions:
  • ATP is a source of free energy that drives unfavorable reactions. Which of the processes are coupled to the dephosphorylation of
    9·1 answer
  • What is the function of the kidneys? to filter waste material from the blood to convert glucose into glycogen to add oxygen to t
    12·1 answer
  • Researchers have reported that the number of different species of fish found in certain areas of the ocean has been greatly redu
    13·1 answer
  • Which of these occurs during s phase
    11·1 answer
  • What color do you think an object would be if it reflected all colors of the visible spectrum?
    8·2 answers
  • Mrs. Kowolski surveyed all the students in her five classes, asking about their favorite desserts. She recorded the data in the
    14·2 answers
  • Why is earths interior layered?
    11·1 answer
  • A group of friends wants to go to the amusement park. They have $169.50 to spend
    12·2 answers
  • What is the result of a cross between a heterozygous brown eyed man and a blue eyed woman
    5·1 answer
  • I need help with this
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!