In your own words, explain how the planets Venus and Mercury can be located in the night sky.

Biology

2 answers:

Reptile [31]3 years ago

7 0

Answer:

After you've spotted Venus in evening twilight, look just to its right for Mercury, assuming you live north of the equator. If you live south of the equator, look below and to the left of Venus.

Explanation:

Andrew [12]3 years ago

5 0

Answer:

draw line with your mind's eye between Venus in the Sunset Point Mercury will be along that line below Venus near the Sunset Point then watching the coming evenings as mercury ascendant evening Sky while Venus descends toward its June 3rd passage between the Earth and Sun

You might be interested in

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

liubo4ka [24]

The mRNA generated below was produced in the nucleus of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.