1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
netineya [11]
3 years ago
5

Which of the following correlation coefficients is less likely to occur?

Biology
1 answer:
Evgen [1.6K]3 years ago
4 0

Answer:

c. -0.78

Explanation:

Correlation coefficients are used to measure the relationship between two variables.  correlation coefficients lies between -1 and +1.

Correlation coefficients greater than zero indicates positive correlation, less than zero indicates negative correlation and zero shows no relationship between the two variables.

Large positive or negative correlations have very less chances to occur, so large negative correlation will have less chances to occur because sampling variation gives large negative correlation by chance.

Hence, the correct answer is c. -0.78.

You might be interested in
Because she is so active, cardiovascular fitness is important to Vicky. She learns that hemoglobin is an important globular prot
vaieri [72.5K]

The answer is Iron, this is the important mineral that she needs to obtain as this will help her in her ways to cardiovascular fitness as this mineral helps the hemoglobin to build in her body and for her t be able to get enough nutrients.

5 0
3 years ago
Read 2 more answers
What would most likely happen if the algae were removed from this ecosystem?
IRISSAK [1]
The tadpole would die out. Which would cause the sudden decrease I duck and frog.

6 0
3 years ago
Read 2 more answers
Someone please calculate the ratio of offspring please help pleaseeeeeeeeeeeeeeee
Over [174]

Answer:

2. 1 Pink : 1 white

3. 1 Red : 1 Pink

4. 1 Red : 2 Pink : 1 White

Explanation:

This question involves a single gene coding for flower colour in snapdragon plants. The alleles of the gene exhibits incomplete dominance i.e. the red allele (R) ia not completely dominant over the white allele (W), hence an intermediate pink phenotype (RW) is formed. Based on this, a red snapdragon will have genotype, CRCR while a white one will have genotype, CWCW. The intermediate pink phenotype will have a genotype, CRCW.

The image attached to this question shows four crosses between different traits.

In the second cross between a pink (CRCW) and white offspring (CWCW), 2pink and 2white offsprings will be possibly produced in the ratio 1:1.

In the third cross between a red (CRCR) and pink (CRCW) snapdragon, 2 red and 2 Pink offsprings will possibly be produced in a ratio 1:1.

In the fourth cross between a pink (CRCW) and pink (CRCW) snapdragon, red, pink and white offsprings will be produced in the ratio 1:2:1.

See attached image for the complete punnet square. Note that, there was a mistake in the Genotype of the last cross i.e. pink has genotype CRCW not CWCW.

5 0
3 years ago
How do protozoans live?
katovenus [111]

Answer:

They live in fresh water, marine or soil. They feed off of bacteria and other protozoa.

Explanation:

5 0
3 years ago
Read 2 more answers
Firstly, plant cells have a cell wall that surrounds the cell membrane, whereas animal cells do not. ... These additional organe
VashaNatasha [74]

Answer:

Explanation:

This question appears incomplete. However, one of the main differences (in organelles) between plants and animal cells is the absence of cell wall and chloroplast in animal cells while both organelles are present in plant cells. The cell wall is outside of the cell membrane. The cell wall provides rigidity and support to the plant cell while the chloroplast is the cellular "machinery" for photosynthesis. The chloroplast contains the green pigment called chlorophyll which provides green plants with there colour and assist the plants in absorbing/capturing of sunlight/energy for the purpose of photosynthesis (self production of food by green plants).

7 0
3 years ago
Other questions:
  • Jason is blindfolded and cannot verbally identify objects in his left hand, which suggest that he has had a dyslexic episode a l
    12·1 answer
  • Part A: Explain why and how the polar covalent bonds found in water molecules are responsible for water's ability to dissolve ma
    10·1 answer
  • What meiotic process, relative to the number of chromosomes of a given species, accounts for a significant amount of genetic var
    14·2 answers
  • Occasionally, one space object travels through the shadow of another space object. When the moon moves between the sun and Earth
    8·1 answer
  • How does species diversity vary with (a) latitude in terrestrial communities, (b) ocean depth, and (c) pollution?
    8·1 answer
  • Which of the following two lands features are formed by erosion
    9·1 answer
  • How to reduce pimples ?​
    12·2 answers
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • How are cells that go through meiosis different than regular body cells? (Select any
    6·1 answer
  • This process can release energy for the cells without using any oxygen
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!