1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gre4nikov [31]
4 years ago
9

What systems make up the marine iguana?

Biology
1 answer:
maw [93]4 years ago
6 0

water and like forests

Explanation:

You might be interested in
Does the wire in the electrical cord of an electric kettle have a higher or lower resistance than the heating element inside the
STatiana [176]

higher is da answer

Explanation:

6 0
3 years ago
Which of the following is not true if deciduous forests
never [62]

Trees grow lush green leaves in the spring, but they all fall out when it gets closer to winter

7 0
3 years ago
THE RIGHT ANSWER WILL RECIEVE A BRAINLEST AND POINTS AND THANXS!!!
Flauer [41]
Chymotrypsin
pepsin
and trypsin
hope u found this useful
6 0
4 years ago
Read 2 more answers
Some molecules are too big to pass through the phospholipid bilayer of the cell membrane. These molecules need to pass through _
pogonyaev
These molecules need to pass through specific proteins or transmembrane proteins embedded in the cell membrane. A specific type of an integral membrane protein.
8 0
4 years ago
Read 2 more answers
Some have speculated that the origin of life occurred at geothermal vents. amino acids can form there. compared to the amino aci
cluponka [151]

There are a number of amino acids that have formed under certain environmental conditions if the required elements are present and the energy conditions ar compatible with chemical assembly. These conditions have also allegedly formed amino acids on meteors, asteroids and comets.


But, amino acids are a very minor component of more complex biochemical assemblies required for life. Pentose sugars are also required, which form under different environmental conditions than amino acids. More importantly, only left-handed homochiral amino acids and right-handed homochiral sugars can form functioning biochemical assemblies that are viable in an organism. But, natural conditions, like hydrothermal vents only produce racemic versions of sugars and acids, meaning they are always approx. 50% left and right handed. This is fatal to forming viable biochemical assemblies.


Further, it is not possible for all of the 20+ homochiral amino acids needed for a living organism to form naturally. The only ones found have been the simpler amino acids. Also, the 4 critical nucleotide amino acids, C, G, A, T, do not form naturally, are not homochiral, nor in the right proportions.


The geo/hydrothermal vent conjecture is nonsensical. These are open systems, susceptible to currents, mineral contamination, salinity, ph, and temperature, making them a totally unacceptable environment for the precise and exact placement of elements to assemble to form life.

3 0
3 years ago
Other questions:
  • Explain why actively growing cells are usually small in size
    7·1 answer
  • About what percentage of eukaryotic DNA transcribes protein?
    12·1 answer
  • Like animals, plants undergo cellular respiration to produce energy. Plants use oxygen and release carbon dioxide and water. Wat
    6·2 answers
  • Oxygen combines with nitrogen to form what type of chemicals that are used by plants
    6·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • How might the surface of the Earth be different if it were not divided into tectonic plates?
    13·1 answer
  • Approximately what wavelength of light is best absorbed by chlorophyll a, the pigment that participates directly in the light re
    9·1 answer
  • 14. The attraction among molecules of different substances is called
    12·1 answer
  • You are a prestigious scientist working in a lab whose most recent project includes the creation of a series of drugs that will
    6·1 answer
  • Why are rocks not melting deep in the earth’s crust?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!