1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
harina [27]
3 years ago
15

Which of the following would differ if you compared the same reaction taking place with and without an enzyme

Biology
1 answer:
SIZIF [17.4K]3 years ago
3 0

Answer:

The correct answer is - option C.

Explanation:

Chemical energy is the energy that every substance or chemical have and its not affected by the presence or absence of the enzyme, while the activation energy is the required energy to initiate for a chemical reaction. If the energy of the chemical reaction is less than the activation energy reaction will not take place.

Presence of a enzyme lowers the amount of the energy for the initiating the reaction which is activation energy and the chemical reaction takes place.

Thus, the correct answer is - option C.

You might be interested in
What must come together in order for atp to be made
kompoz [17]
Cellular respiration is needed for atp to be made. it needs sunlight, glucose and oxygen. i’m pretty sure the main answer would just be glucose and oxygen though.
6 0
2 years ago
An interesting observation made by the firefighters was that some parts of the forest seemed to escape the flames. The crown fir
Savatey [412]

Answer:

According to the previous observational study it is possible to notice that thinning determined in great way the rate of trees that survived the fire.

Explanation:

In general the trees that had been previously cut, were the ones that presented more resistance to the fire, while the trees that had not been thinned were the ones that were severely affected in the spreading conflagration. Reason why in comparison of these two samples, it would be possible to conclude that previously cutting down trees can survive better to the spreading fire.

8 0
3 years ago
The gravitational force that Earth exerts on an object is called the objects
Nina [5.8K]
When the only force acting<span> on a falling </span>object<span> is </span>gravity<span>, the </span>object<span> is said to be in free fall. </span>force<span> of </span>gravity<span> is an unbalanced </span>force<span>, which causes an </span>object<span> to accelerate. Near the surface of Earth, the acceleration due to </span>gravity<span> is 9.8 m/s2.</span>
8 0
3 years ago
Identical twins who have separate placentas are somewhat less similar than identical twins who share a placenta. This best illus
Jobisdone [24]

Answer:

prenatal environments

Explanation:

Depending on the number of fertilized eggs and when the zygote division occurs, there are different types of twins. For example, If the zygote is formed by the union of an ovule and a sperm that after fertilization is divided to create two embryos, they are born identical twins, these babies carry the same genetic information.

4 0
3 years ago
Explain two ways that mountain climbing and rock climbing are different?
babymother [125]

Please, please pick me as brainiest. It would make my day!

Answer:

The best way to look at it is that mountain climbing is a sport that involves the scaling of a mountain in its entirety. ... However, rock climbing by itself is so extensive that it can be and often is its own sport. Some mountains are more easily traversed by hiking, such as Mount Baker.

4 0
3 years ago
Other questions:
  • What is the purpose of the cell membrane?
    6·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Circle the letter of each sentence that is true about genes, chromosomes, and proteins.
    7·1 answer
  • A pathologist is a person who works in the field of pathology. What would a pathologist most likely do?
    8·2 answers
  • What effect does an increase or decrease in the ph of the cell cytoplasm have on proteins?
    8·1 answer
  • ______________ are produced in the testes.<br> Eggs<br> Sperm<br> Ovas<br> B-cells
    9·2 answers
  • External respiration takes place in the _____.
    11·1 answer
  • Earth's constantly absorbs energy from the sun, yet stays at a relatively constant temperature. Explain how
    6·1 answer
  • Place your cursor over the boxes on the different chromosome numbers below and match the chromosome number to the description of
    13·1 answer
  • What type of association is fern on palm trees and explain​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!