1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GenaCL600 [577]
3 years ago
8

Función del sistema Nervioso

Biology
1 answer:
Alex787 [66]3 years ago
3 0

Answer:

El sistema nervioso consiste en el cerebro, la médula espinal, los órganos sensoriales y todos los nervios que conectan estos órganos con el resto del cuerpo. Juntos, estos órganos son responsables del control del cuerpo y la comunicación entre sus partes.

You might be interested in
The electrons for photosynthesis come from:
user100 [1]

Answer:

The energy comes from electrons produced by oxidation of biological molecules.

Explanation: In photosynthesis, the energy comes from the light of the sun.

Hope this helped! :)

6 0
3 years ago
Where does a 'thought' go when forgotten
forsale [732]

Answer:

It dont go anywhere because it never existed

Explanation:

its gone its gone

4 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Were there many or few vessels serving as conduits between the lungs and the heart? why is this important?
EastWind [94]
True, there are many vessels serving as a conduit<span> between the lungs and the heart. 

The number of the vessel is many because all the carbon dioxide from body need to be released at the lungs. More vessel means more surface area and blood flow rate to do the diffusion of the gas which means increased diffusion rate. This will allow the lung to transfer oxygen and dump carbon dioxide faster.</span>
5 0
3 years ago
Explain why the ratio of motor neurons to muscle fibers is greater in muscles that control eye movement than in postural muscles
EleoNora [17]

Answer:

The muscles of the eye cover a greater number and in turn carry out greater fine motor skills.

Explanation:

Alpha motor neurons are neurons that invent the skeletal muscle, that is, striated, so that through the motor plate that is the unit that unites them, an action potential is transmitted that contracts the sarcomeros of the elastic fibers and the z lines. come closer, each eye movement is much more precise than the locomotion of the lower limb, which carries greater innervation in each muscle bundle due to the specificity of the movement, this is how more alpha motor neurons are required to mobilize the eye than a leg.

7 0
3 years ago
Other questions:
  • How are genes coordinately controlled in eukaryotic cells? select all that apply?
    9·1 answer
  • Why it is easier for a fall or blow to cause a dislocated shoulder injury than for a comparable fall or blow to cause a dislocat
    11·1 answer
  • Why did early scientists believe that plants were fundamentally different than animals?
    11·1 answer
  • Why were Victorian hat makers prone to mercury posioning
    14·1 answer
  • What is solar thermal energy used to do- heat homes or power homes?
    10·2 answers
  • Only carbohydrates are broken down into which of the following subunits
    7·1 answer
  • Which of these is not true of living cells
    11·1 answer
  • What is the effect of DNA copying which is not perfectly accurate on the reproduction process?​
    10·2 answers
  • Air passes from the nose into the bronchi true or false?
    8·1 answer
  • Describe steps that can be taken to improve water quality through water conservation
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!