1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
777dan777 [17]
3 years ago
6

A female may neglect, kill or eat their offspring because of ______ HELPPP PLEASEEE

Biology
2 answers:
Georgia [21]3 years ago
8 0

Answer:

sorry have not learned that yet

Explanation:

satela [25.4K]3 years ago
8 0
I think because they are not well
You might be interested in
If something disrupted your food web, what is the immediate impact and what is the larger impact?
Ulleksa [173]

Answer:

The animals would look for other food to eat which would add more disruption, which would then cause the all of the ecosystem to fall apart.

Explanation:

7 0
3 years ago
Describe two situations in which a healthy aphid population would start to experience negative population growth.
pickupchik [31]

Answer:

Product Quality · Nutrition and Feeding · Health and Care What determines whether an insect population explodes or just moves Eggs may hatch in spring into parthenogenetic females, the beginning of the new line, to see if we can observe any of these phenomena on captive aphids on.

Explanation:

8 0
3 years ago
What is segmented digestive system, appendages
astra-53 [7]
Segmented digestive system, appendages are animal characteristics. 
Animals are a major group of organisms, classified as the kingdom Animalia or metozoa. Animals have several characteristics that set them apart from other living things. They are all eukaryotic and usually multicellular, which separates them from bacteria and most protists. Different animals differ in their own characteristics such as appendages, segmentation among other animal characteristics. 
5 0
3 years ago
Incomplete Dominance Predicting Flower Color in Snapdragons
Mashutka [201]

Answer:

In snapdragons, the color of the flower is controlled by incomplete dominance. The two alleles are red (R) and white (r).

Explanation:

4 0
3 years ago
Match each feature created by erosion to the correct description
Leno4ka [110]

Answer: Please refer to Explanation

Explanation:

Stream - A series of connected channels that fills with water.

Rill - A small groove in soil created by runoff.

Gully - A channel of connected grooves created by runoff.

- Occurs when rills get bigger due to more runoff and then connect to become even bigger.

Tributary - One of many channels that connect to form a river.

- Tributaries feed rivers but never the open sea.

5 0
3 years ago
Other questions:
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • How much of the protein consumed by humans around the world is fish?
    13·2 answers
  • Catabolism +anabolism is
    12·1 answer
  • In which zone are most producers found?
    13·2 answers
  • When cells express different genes, what occurs?
    7·1 answer
  • Which feature do both roundworms and segmented worms have?
    14·1 answer
  • Which is not an example of matter and energy cycling through living things
    11·2 answers
  • 2. Scientists predict the sun will give us energy for at least how much longer?
    8·2 answers
  • Need help please ASAP !!
    7·1 answer
  • Four hundred beetles of the same species were sprayed with an insecticide. Several weeks later, nearly all the beetles were dead
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!