1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Len [333]
3 years ago
5

What is the purpose of sub culturing​

Biology
1 answer:
mojhsa [17]3 years ago
4 0

Answer:

In biology, a subculture is a new cell or microbiological culture made by transferring some or all cells from a previous culture to fresh growth medium. This action is called subculturing or passaging the cells. Subculture is used to prolong the life and/or expand the number of cells or microorganisms in the culture.

You might be interested in
Which of these questions can be answered using science? Is human travel beyond our solar system possible? Should the use of gree
kari74 [83]

Answer:

Should the use of green energy be increased?

Explanation:

6 0
3 years ago
How many elements have been found to occur in nature?<br> 90<br> 092<br> 96<br> 99
wel

Answer:

92

Explanation:

5 0
3 years ago
Read 2 more answers
Help I'm confused!
aev [14]

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

7 0
3 years ago
Which stage of viral reproduction takes place when the spikes of the virus bind to a specific receptor molecule on the surface o
viva [34]

Answer:

Attachment stage

Explanation:

Viruses are organisms that are incapable of replicating on their own, instead they infect a living host in order to make use of its transcriptional, replication and gene expression abilities to multiply. This process of infection characterizes the reproductive life cycle of the viral cell.

Normally, viruses are specific when infecting their hosts but they generally commence the infection cycle with ATTACHMENT. In this stage, the viral cell with the aid of its proteinous capsid binds to specific receptor site on the cell membrane of its host cell before making entry by incorporating its genetic material.

3 0
4 years ago
Please help! Thanks!
damaskus [11]

Answer:

the basic unit of DNA is nucleotide. It is found in the Nucleus:)

Explanation:

Hope this helps:)

3 0
3 years ago
Other questions:
  • Question 1
    8·1 answer
  • Fertile land is by the _____________ artist ____________.
    13·1 answer
  • 6. What is the sugar found in DNA?
    11·1 answer
  • What are three major differences between rna and dna?
    6·1 answer
  • 3. Evergreens are trees that are adapted to keep their leaves all year long. Most of the trees that grow in the taiga biome are
    5·1 answer
  • QUESTION 5
    7·1 answer
  • What type of digestion is it when food is physically broken into smaller pieces?
    7·1 answer
  • Explain the 3 steps you would need to calculate the density of a marble
    6·1 answer
  • Le gabbro est une roche volcanique et grenue. vrai ou faux
    9·1 answer
  • What is fire exclusion?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!