1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
3 years ago
5

What happens in terms of energy when a moving car hits a parked car, causing the parked car to move?

Biology
2 answers:
bagirrra123 [75]3 years ago
7 0
The moving car has potential and kinetic now, so does the parked. This is because of the sudden collision

adelina 88 [10]3 years ago
5 0

Answer: A

just did it

You might be interested in
Why is one mutation not enough to result in cancer​
Lena [83]

Answer:

A single mutation is unlikely to result in cancer. Cancer is usually caused by a series of mutations that accumulate throughout the course of a person's life. As a result, cancer is more common in older adults. They've seen more chances for mutations to accumulate.

Explanation:

6 0
3 years ago
A_________ ________is a set of chemical symbols that indicate the elements in a compound and the relative proportions of those e
Jlenok [28]
The answer is Chemical Formulas
6 0
3 years ago
What is an outcome variable? Give an example. (plz i need this)
daser333 [38]

Answer: An independent variable, sometimes called an experimental or predictor variable, is a variable that is being manipulated in an experiment in order to observe the effect on a dependent variable, sometimes called an outcome variable.

Explanation: Example: What is a good outcome variable for deciding whether cancer treatment in a country has been improving?

A first thought might be "number of deaths in the country from cancer in one year." But number of deaths might increase simply because the population is increasing. Or it might go down if cancer incidence is decreasing.  "Percent of the population that dies of cancer in one year" would take care of the first problem, but not the second.

This example makes the point that a rate is often a better measure than a count.

5 0
3 years ago
Read 2 more answers
Milk is a healty food for a adult cat
Neko [114]
Most cats are lactose intolerant, which means milk is not healthy for cats since they don't have the enzymes to break down the lactose in milk.
8 0
3 years ago
НЬ ТА Ts
Troyanec [42]

What are the chances that their offspring will have sickle cell anemia?

100%

4 0
3 years ago
Other questions:
  • Desert climates can have very hot days and very cold nights this is because of what
    9·1 answer
  • What is the definition of cell membrane?
    7·2 answers
  • What is possible cause of the decline in an amphibian on the planet
    6·1 answer
  • Carbon is found in only living organisms true or false
    7·2 answers
  • Which of the following groups is a population?
    12·1 answer
  • Which of the following are characteristics of life used to categorize something as a living organism?
    12·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • A Bb guinea pig crosses with a Bb guinea pig. All of the four offspring are black. How did this happen?
    7·1 answer
  • Reading Focus Question:<br> Which parts of the biodome<br> contain carbon?
    11·1 answer
  • Beneficial micro-organisms that are responsible for breaking down organic matter are called?.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!