1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PilotLPTM [1.2K]
3 years ago
14

In flies, long wings are a dominant trait, and short wings are a recessive trait. Medium wings are the heterozygous trait. Based

on this information, if a homozygous long-winged fly is crossed with another a heterozygous fly, their offspring will have which percentages for long, medium, and short wings? Assume random chromosome segregation.
Biology
1 answer:
IgorC [24]3 years ago
3 0

Answer:

there is a 100% chance it will contain the recessive allele and a 50% chance it will have the recessive trait  

I tried to attach a document I made of a punnet square to help further explain  

Explanation:

You might be interested in
Trace fossils are not actual pieces, molds or impressions of organisms.<br> O True<br> O False
julsineya [31]

Answer:

your answer is no

Explanation:

5 0
3 years ago
Read 2 more answers
Type II topoisomerases display all of the following characteristics EXCEPT
Firlakuza [10]

Answer:

The correct answer is option A. "They only introduce supercoiling and cannot relax a covalently closed circular DNA".

Explanation:

Type II topoisomerases are enzymes that regulate the winding an unwinding of DNA during DNA replication. Basically, these enzymes are the scissor that remove the knots and tangles formed during the replication process. Is false to affirm that type II topoisomerases only introduce supercoiling and cannot relax a covalently closed circular DNA. Bacterial type II DNA topoisomerases  work with the circular DNA of bacterium by changing the linking number of circular DNA by ±2.

6 0
3 years ago
What is plant ????<br><br>ASAP​
Lera25 [3.4K]

Answer:

a living organism of the kind exemplified by trees, shrubs, herbs, grasses, ferns, and mosses, typically growing in a permanent site, absorbing water and inorganic substances through its roots, and synthesizing nutrients in its leaves by photosynthesis using the green pigment chlorophyll.

Explanation:

5 0
3 years ago
Read 2 more answers
How do dna molecules vary from one species to another?
Andru [333]
<span>Organisms all possess DNA as their genetic material. What differentiates them (and their DNA) is the sequence of base-pairs within the DNA. The base-pairs are actually specific sequences of nucleotides (i.e. adenine , thymine, guanine and cytosine, labelled A, T, G, and C respectively) which encode genes. In other words, the DNA in each organism is made of these bases, but their sequences differ from organism to organism.</span>
3 0
3 years ago
Viral STIs are not curable and can only be controlled with medications.<br> a. True<br> b. False
yanalaym [24]
True, viral STIs are not curable and can only be controlled with medications
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which chemical shown in figure 8-3 is an electron carrier molecule
    5·2 answers
  • Which molecule listed in the chart is a protein
    6·2 answers
  • _______ is (are) associated with permafrost
    5·1 answer
  • Compare the behavior of an endotherm and an ectotherm on a hot summer day. How does each organism respond to changes in the envi
    7·2 answers
  • Which is a basic unit of a square molecule
    13·1 answer
  • How much water are we pumping out of the ground using wells in the US alone?
    14·2 answers
  • List the genetic disorders found on chromosome 11. What do you know about any of those disorders?
    9·2 answers
  • - 7th Grade Work -
    15·2 answers
  • How do bacteria and archea reproduce most of the time?
    14·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!