1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vesnalui [34]
3 years ago
6

What term is used to describe the

Biology
2 answers:
Elza [17]3 years ago
8 0
B. population density

Explanation: took Biology
mote1985 [20]3 years ago
3 0
The term used to describe the number of individuals per unit are is population density so answer choice C
You might be interested in
All of the kapok trees that live in the Amazon rain forest make up a
KIM [24]

The answer is D) Population

8 0
3 years ago
A hormone has been synthesized in the rough endoplasmic reticulum of an endocrine cell after which it has moved into the Golgi c
Oxana [17]

Answer:

peptide and protein hormone

Explanation:

Peptide and protein hormones are composed of amino acids with latter being longer in length. They are synthesized in rough endoplasmic reticulum where they undergo various modifications like N terminal signal sequence removal and glycosylation to form prohormones. These prohormones are sent to golgi apparatus where they are packaged in secretory vesicles. In response to a stimulus the appropriate vesicle is released via exocytosis.

They can show  regulated secretion where the hormone is stored in vesicles for a long time and then released in large amount in bursts for a proper stimulus. Sometimes they also show constitutive secretion where they are released slowly and steadily by the vesicles.

6 0
3 years ago
Half of the moon is always lit except during an eclipse.<br><br> True or false?
olga nikolaevna [1]

Answer:

Half of the Moon's surface is always illuminated by direct sunlight, except during lunar eclipses when Earth casts its shadow on the Moon. Just how much of that light we can see from Earth varies every day, and we refer to this as a Moon phase.

Orbits: Earth

Explanation:

8 0
2 years ago
Read 2 more answers
¿por que es importante para el hombre que la milasa actué sobre el almidón? <br> Ayuda porfa
loris [4]

Answer:

can you put this in English pls

8 0
2 years ago
What kind of claim type does this statement make? Abbey Road is a much better album than Let It Bleed.
shtirl [24]
A . Value because that’s your valued opinion
8 0
2 years ago
Read 2 more answers
Other questions:
  • Which of the following is not a stage in the development of a thunderstorm?
    8·2 answers
  • Protists with complex bodies covered with hairlike structures known as cilia are called
    5·1 answer
  • Members of two different species possess a similar-looking structure that they use in a similar way to perform about the same fu
    10·1 answer
  • 16. YOU CAN DRIVE IN A CARPOOL LANE IF YOU:
    7·2 answers
  • What is the best definition of the term imagery?A student completed a lab report. Which correctly describes the difference betwe
    6·2 answers
  • What makes one mineral harder than the other? Explain
    9·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • A dichotomies key for insects is given. To what order does an insect with two pairs of scaly wings belong
    9·1 answer
  • Hi need answer to this question if possible
    12·2 answers
  • NOW!!!!!!!!!!!!
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!