1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
devlian [24]
2 years ago
11

Each year as the weather gets cold, gray whales swim over 10,000 miles from arctic waters south to coastal areas of northern Mex

ico. After their young are born, they return to the Arctic.
The whales are responding to an stimulus.
This response is an example of.
Biology
2 answers:
inysia [295]2 years ago
7 0
Gestation is 11-12 months; migration and reproduction are connected, since it's best for the mothers to reach warm waters before giving birth
BARSIC [14]2 years ago
5 0

Answer:

1.external

2.migration

Explanation:

I took the ur

You might be interested in
A recessive allele does not affect the phenotype of a heterozygous person.
Effectus [21]

Answer: A. true

Explanation: The phenotype is the physical characteristics of a person. So, if a person has brown eyes, which may be a characteristic that is dominant, then they would have a genotype of BB or Bb. The reason why Bb, heterozygous, is not a different color is because the recessive b does not affect the dominant B allele.

Hope this helps!!!

4 0
3 years ago
I'm so confused on how to do punnet squares. help?
lubasha [3.4K]
A brown heterozygous rabbit is an animal hat has two different alleles ("B" & "b" are different. One is capital (dominant), and one is lowercase (recessive). a homozygous white rabbit would be someone who has the same alleles. For example, it could have two capital B's (BB) or two lowercase b's. However since we know white fur is recessive and the rabbit is showing recessive WHITE fur, we would represent it as two little b's.

Let's set up our punnett square by drawing a square or box


Then, divide the box up into four equal squares inside the box.

Now, we are going to put our genotypes (Bb & bb) above the box and on the left side ( as shown in the picture.

You cross them kind of like cross multiplying. Remember, the capital B always comes first when needed.

THERE'S YOUR PUNNETT SQUARE! Let's solve the problems.

1.
Genotype is the genetic code. (Ex: Bb, VV, rr)
Phenotype on the other hand is the physical trait (brown fur, blue eyes, rolling your tounge)

So the genotypes of the new generation are Bb & bb

While the phenotypes are brown fur and white fur. Remember, the dominant trait always covers up the recessive. For example, Bb. The rabbit would take brown fur but could give white fur to her offspring because she has a recessive trait for white fur. However, bb would give the rabbit white fur since there is no dominant trait to cover up the recessive.

2.
50% of the rabbit are going to be brown and 50% of the rabbits are going to be white.

This is because the recessive gene isn't covered up by a dominant trait for 50% of the rabbits (bb) but the other 50% will have brown fur because the dominant trait is covering it up.

Hope that clears everything up about punnett squares. Good luck! (:

4 0
2 years ago
Read 2 more answers
Which organelle is responsible for wilting?
makkiz [27]

Vacuole is the answer.

Wilting is the loss of rigidity of non woody parts of plants and occurs when turgor pressure falls. 

The vacuole controls turgor pressure. Turgor pressure dictates the rigidity of the cell and is associated with the difference between the osmotic pressure inside and outside the cell.

When a plant receives adequate amounts of water, the central vacuoles of its cells swell as the liquid collects within them creating a high level of turgor pressure which helps maintain the structural integrity of the plant along with the support of the cell wall.

In the absence of enough water , central vacuoles shrink and turgor pressure is reduced  compromising the plant's rigidity so that wilting takes place.

5 0
3 years ago
Read 2 more answers
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
The paths of global winds curve because of what is known as the _____.
padilas [110]
The best option is A Coriolis Effect. The Coriolis effect is most apparent in the path of an object moving longitudinally.
5 0
3 years ago
Read 2 more answers
Other questions:
  • What are DNA machines, according to Kraves?
    11·1 answer
  • If the phenotype of pea pod color is determined by incomplete dominance and the combination of an allele for yellow seeds and an
    11·1 answer
  • What techniques do scientists use to study ocean sediments
    6·1 answer
  • What is the difference between integral and peripheral membrane proteins?
    6·1 answer
  • A doctor diagnoses a patient with a disease called polymyositis. The patient tires quickly when walking, has difficulty swallowi
    15·2 answers
  • Devon is being treated for anxiety. he is connected to an instrument that records muscle tension. his job is to try to reduce mu
    13·1 answer
  • The earth’s surface stays completely the same over time. It never changes
    9·1 answer
  • Monoclonal antibodies to double-stranded RNA as probes of RNA structure in crude nucleic acid extracts. Nucl. Acids Res
    8·1 answer
  • What is the source ol the carbon dioxide that is used in photosynthesis?
    7·1 answer
  • What are the function of cerculatory system
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!