1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cluponka [151]
3 years ago
10

Which of the following is NOT a tissue type? *

Biology
1 answer:
DochEvi [55]3 years ago
5 0
Answer d
Explanation
You might be interested in
The night sky is filled with images of wild animals.
kipiarov [429]

Answer: A

Explanation:

4 0
3 years ago
Read 2 more answers
What would the complimentary RNA strand be if one of the strand's base sequence was:
goldfiish [28.3K]
T A C T T C A T A are the answers
3 0
3 years ago
Read 2 more answers
Which of the following outcome would be most likely if the proteins emmbedded in a cell membrane became unable to function prope
Andreas93 [3]
C) The Cell Would Be Forced To Divide as substances continued to build up inside the cell
8 0
3 years ago
Read 2 more answers
Carbon monoxide a is consumed by plants for photosynthesis b is produced by plants during photosynthesis c blocks oxygen transpo
IrinaVladis [17]

Answer: Option C) blocks oxygen transport in human blood

Explanation:

Carbon monoxide (CO) is one of the oxides of carbon formed when fuel is incompletely burned. It can be generated from exhaust pipe of vehicles, electric generators.

When inhaled CO attaches to the hemoglobin portion of the red blood cells, forming a bound complex called CARBOXY-HEMOGLOBIN, that is unable to transport oxygen to the body tissues.

Thus, by this mechanism Carbon monoxide blocks oxygen transport in human blood

5 0
3 years ago
The oldest rocks and minerals on earth's surface have been found in canada and australia and are from the:
Orlov [11]
The time period was called the Hadean Eon, and the rocks themselves are nearly 4.4 billion years old
3 0
3 years ago
Other questions:
  • Which of the following are functions of stems in a typical plant? Choose three correct answers,
    14·1 answer
  • _ oil is a non-animal-based source of saturated fat that has numerous health benefits, but also limited research on its long-ter
    15·1 answer
  • ¿Qué significa que cada receptor responde a un estimulo?
    6·1 answer
  • look at this picture of a trilobite. life in the ocean once involved these animals, but it no longer does. what is the likely re
    11·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Nucleic acids, proteins, and other large biological molecules are known as polymers because
    8·2 answers
  • Compare the two processes: mitosis and meiosis. Can you identify the the true statements about the two? Meiosis results in four
    11·1 answer
  • What molecule contains an organism's genetic material, passed down from parents to their offspring? A. Protein B. Lipid C. DNA D
    13·2 answers
  • Which of the following are missing from the food web shown above?
    8·2 answers
  • What are found in the nucleus of an atom?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!