1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brut [27]
3 years ago
11

Damian grew a plant from a leaf cutting. How did the plant reproduce?

Biology
1 answer:
Brums [2.3K]3 years ago
8 0

Answer:

D.

Explanation:

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Which sentence from the passage gives the best clue of what organizational pattern is used?a. "they have much larger ears than a
AnnyKZ [126]

'They have much larger ears than asian elephants' is the sentence which describes how organizational pattern is used.

<h3>What is Organizational pattern?</h3>

This is used to show relationships between supporting details in a passage or text.

The sentence which depicts this from the passage is 'They have much larger ears than asian elephants'.

Read more about Organizational pattern here brainly.com/question/3903606

6 0
2 years ago
What is NOT a physical change
natka813 [3]

Answer:

a

Explanation:

7 0
2 years ago
Read 2 more answers
Which is not one of the main areas of earth science
shtirl [24]

Astrology is not a main are of science



7 0
3 years ago
Select all of the answers that apply. The Sun emits a lot of radiation. The different types of radiation are the electromagnetic
beks73 [17]
<span>radio waves, microwaves, gamma rays, X-rays, visible rays

Hope this helps</span>
3 0
3 years ago
Read 2 more answers
Other questions:
  • What is the abbreviation that refers to a wear and tear disease caused by the breakdown and eventual destruction of cartilage in
    8·1 answer
  • You have designed a drug that irreversibly binds to the p-site of the ribosome. what is the outcome for a growing bacterial cell
    6·1 answer
  • HELP ME PLEASEEEEE I WILL MAKE THEM THE BRAINLIST ANSWER IF YOU ANSWER NOW!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    6·1 answer
  • Does budding produce genetically different organisms?​
    13·1 answer
  • Which action would be most likely to limit scientific research on genetic<br> modification of food?
    10·2 answers
  • In which of the following can a change be directly observed? A. alleles B. genotypes C. phenotypes D. mutations
    5·1 answer
  • Mendel published his results in 1865, but the significance of his work was not recognized at that time. What helped scientists b
    9·1 answer
  • Pollination is the transfer of_Pollen from the _____________ to the ______________.
    14·1 answer
  • Soil is a mixture of _______.
    12·2 answers
  • All organisms have the same feedback mechanisms that help them maintain homeostasis.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!