1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nat2105 [25]
3 years ago
15

Why do plants require oxygen?

Biology
1 answer:
Luden [163]3 years ago
3 0

Answer:

Plants need oxygen to survive, and plant cells are constantly using oxygen. Under certain circumstances, plant cells need to take in more oxygen from the air than they generate themselves.

Explanation:

You might be interested in
The table shows the energy that is stored in three types of organic molecules. What is the best conclusion based on this data?
Alina [70]

The answer is B hope this helps : )

3 0
2 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
The elements or compounds that come out of a chemical reaction are?
Jet001 [13]
Reactants Begin a Reaction and Products Complete a Reaction
4 0
3 years ago
What is the role of b cells in the human immune system
Natasha_Volkova [10]
B cells mature in the bone marrow, which is at the core of most bones It recognises invaders by the shape of molecules -antigens- on their surfaces. With the help of T cells, B cells make proteins called antibodies. The antibodies will help your body become aware of intruders.
4 0
3 years ago
What are 10 thing that classify as a Secondary succession?
eimsori [14]

Answer:

The renewal of a forest after a fire: The fire itself destroys a majority of different types of trees and plant life. Because seeds and roots and other plant and tree parts remain in and on the soil, gradually the plants and trees begin to grow again and eventually returns to the state of the original ecosystem.

The renewal of a crop after harvesting: Without new seeds being planted, the crop can regenerate the following year due to the plants and seeds that remained after harvesting.

A forest renews after logging: Lots of trees were chopped down by loggers to create building materials. Over time, trees grow in and the area returns to its previous state.

A volcanic eruption: In an area where a volcano erupts, lava may cause some damage to the plant and tree life. Over a span of years, however, if there was land that had been affected by the eruption but not necessarily covered in new volcanic rock, the seeds and plant parts and roots in the soil could renew.

On the island of Lawahii, several centuries ago, a fire erupted that caused the destruction of all plants and vegetation. Many years later, the plants and vegetation had grown back in, as the nutrients, seeds and soil remained.

Renewal after disease: A plant population can be very negatively affected by a variety of infectious plant diseases. If the entire population dies, but the soil and roots remain, it is possible for secondary succession to occur and for the population of those plants to to return.

A flood can ruin farmlands. However, because the soil remains after the waters recede, over the course of many years a natural secondary succession can occur and the vegetation that had previously grown there can grow again.

Plants can be very susceptible to attack from pests, particularly if there is an overpopulation of those pests. When this occurs, the plant population in one area can be completely destroyed. However, when the pest overpopulation is resolved, the plants are able to live again and thrive in the soil in which they previously had lived.

Potato scab is a tuber disease that grows on potatoes. If this disease affects a large amount of potatoes, the potatoes may not grow or may be harvested and thrown away. Over time, once the disease has been eradicated, healthy potatoes can grow again.

And also human activities can harm the environment and cause secondary secession.

Explanation:

because it’s true. source: https://examples.yourdictionary.com/examples-of-secondary-succession.html

6 0
3 years ago
Other questions:
  • What kind of animals are best suited to life at the north pole? pick one
    11·2 answers
  • Que funcion cumple el snc?
    14·1 answer
  • What do you think is NOT a characteristic of all living things?
    14·1 answer
  • What is bio diversity hot spot?​
    7·1 answer
  • What type of isolation occurs when species are spread too far out over an area?
    14·1 answer
  • A county has recently evolved from under developed to developed in the birth and death rate has stabilized. This is known as
    10·1 answer
  • Which of the following is true about transcription?
    12·1 answer
  • Which best lists the end products of the light-dependent reactions of photosynthesis?
    9·1 answer
  • Mitosis Inquiry Activity (10 points) 1) In the space below, sketch your group consensus pictures then write the verbal interpret
    12·1 answer
  • Which level of the food web is impacted by littering plastic in Canada? and why?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!