1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rom4ik [11]
3 years ago
5

Which plant is often used as a soil conditioner

Biology
2 answers:
pochemuha3 years ago
7 0

Moss. Moss is mostly used for soil conditioners.

Stella [2.4K]3 years ago
4 0

Answer:

b. The most widespread bryophytes are <em><u>mosses</u></em>

You might be interested in
What are the synergist muscles that help the triceps brachii???
rosijanka [135]
The triceps brachii muscle is the large muscle on the back of the upper limb of many vertebrates. It is the muscle principally responsible for extension of the elbow joint.
3 0
3 years ago
If you have just eaten, your body secretes ______ to uptake glucose; if you have not eaten all day, your body secretes ______ to
pav-90 [236]
If you have just eaten, your body will secrete insulin. Insulin is the hormone that allows glucose to enter cells. That way they will have the proper energy for their normal functions.
If you have not eaten for a while, your body is running out of glucose to feed the cells so it needs to secrete another hormone called glucagon. This hormone is the complete opposite of insulin because it breaks down glycogen, proteins and fats into glucose.
6 0
3 years ago
List one organism and describe all of its adaptations.​
sleet_krkn [62]

Answer:

cactus

Explanation:

heat, water loss,

7 0
3 years ago
Name all of the kingdoms of living things, indicate how they relate to each other.
weeeeeb [17]

Answer: The five kingdoms are: <u>animal, plant, fungi, protist and monera.  </u>The system of biological kingdoms is the way in which science classifies living things according to their ancestry over the course of evolution. they also have common ancestors and therefore share some of their genes and belong to the same family tree.

Hope this helps!

5 0
3 years ago
What is deffusion and give me an example
LUCKY_DIMON [66]
Ex. Air freshener.
simple diffusion is the process of a substance (such as air freshener) moving from high concentration to low concentration with little to no energy.
5 0
3 years ago
Other questions:
  • Science forums matt and monica have been trying to get pregnant for two years. no wonder it is so difficult! they just found out
    15·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which illustration has the correct direction in which an action potential travels through a neuron?
    15·1 answer
  • Charlie contracted Lyme disease when he was bitten by a tick, which is a small spider-like animal. The tick carries harmful bact
    8·1 answer
  • What substance is an important nutrient for pregnant women?
    9·2 answers
  • 8 letter word: living thing that eats other living things ( _ _ _ s _ _ _ _ )
    14·1 answer
  • Endocrine disrupters: are only active in very large doses or exposures only affect the reproductive capability of females affect
    6·1 answer
  • If a tRNA molecule has an anticodon which reads AUG, what was the codon of the mRNA molecule?
    7·1 answer
  • 7. The diagram below represents a plant cell.
    7·1 answer
  • In comparing the behavior of a 10,000 and 45,000 molecular weight protein using sodium dodecyl sulfate polyacrylamide gel electr
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!