i pretty sure its Cytokinesis and Spindle Fibers.
Answer:
The correct answer would be - Cells begin dividing faster, leading to cancer.
Explanation:
In the process of the cell cycle, there are several checkpoints that ensures that the cell is all set to move to next phase, the cell that not match the requirements cell have not move to next phase.
These checkpoints control the rate of cell proliferation or division and if a dividing cell fails to pass through any checkpoints due to the mutation, it is most likely divide uncontrollably and lead to cancerous or tumor cell.
Thus, the correct answer is - Cells begin dividing faster, leading to cancer.
Answer:
The cells wouldn't be able to photosynthesize
Explanation:
Chloroplasts absorb light energy, enabling photosynthesis. if they are damaged then the plant can't get light energy.
Answer: Strict Liability Torts
Explanation:
In the tort law, strict liability is the imposition of the liabilities on the party without even finding a single fault.
The claimant only needs to prove that the tort occurred is done by the defendant and he is only responsible for the faults.
It is considered to be very dangerous as there is no need of prove to show the defendant has done a fault.
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
