Answer;
-Glycogen
The organic molecule called glycogen is formed of branched chains of sugar units.
Explanation;
-Glycogen is a branched polysaccharide of glucose that serves as a form of energy storage in humans, animals, fungi, and bacteria.
-In humans, glycogen is made and stored in liver and muscle cells. Muscle cell glycogen is broken down into glucose, and liver glycogen is broken down into glucose as a circulating energy source glucose for use by the body.
-Glycogen is accumulated in response to insulin and broken down into glucose in response to glucagon. It plays a major role in maintaining the blood-glucose levels, which is vital since some organs in the body such as the brain purely depend on glucose for energy.
Answer: Plant grass and lay straw at the sites.
Explanation:
Runoff is a flow over of water or any other liquid over a surface causing erosion. The flow of water is of high speed and rapid. It is not absorbed by the soil.
Plant grass and lay straw at the sites is the correct option this is because of the fact that the grass and lay straw will absorb the runoff water and prevent the erosion.
I’m not sure I understand your question.
Answer:
Producers, primary consumers, secondary consumers, tertiary consumers
Explanation:
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
