1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irina [24]
2 years ago
9

Anyone please inbox me​

Biology
2 answers:
dusya [7]2 years ago
5 0

Answer:

ok

\blue{\bold{\underline{\underline{}}}}

sashaice [31]2 years ago
4 0

Answer: Why?

Explanation: I hope you are okay.

You might be interested in
After the swim meet, many cheeseburgers were eaten by a swim team of hungry kids.
xxTIMURxx [149]

Answer:

Lol! Also, what is the question? Or is there no question?

Explanation:

4 0
2 years ago
Which of the following correctly sorts the organizational levels of a ecosystem form least inclusive to most inclusive
Naddika [18.5K]

Answer:

population - community - ecosystem - biosphere

Explanation:

<em>The correctly sorted level of organization of an ecosystem from the least inclusive to the most inclusive would be from population to community to ecosystem and finally to biosphere.</em>

A population consists of a group of organism of the same species living in a particular area at a particular time and capable of interbreeding to produce fertile progeny.

A community represents different population of organisms that are interacting with one another. Several populations make up a community.

An ecosystem consists of different communities of organisms that are interacting with themselves and the non living component of the environment.

A biosphere consists of all regions of the earth where living organisms can be found. It consists of different ecosystems that make up the earth.

<u>Hence, the population is least inclusive, followed by the community, then the ecosystem and finally the biosphere.</u>

8 0
2 years ago
Passwords, tokens, and fingerprint scans are all examples of ________. identification authentication authorization credentials
julia-pushkina [17]
The answer to the fill in the blank is option B) Authentication


Passwords, tokens, and fingerprint scans are all examples of Authentication.

We use passwords, tokens and even fingerprints since they can be unique identifications and are usually seen as more secure.

In the above options, fingerprints are seen as the most secure form of authentication since everyone has unique fingerprints.

One of the earliest forms of authentication were time cards used as early as the 1950s and even unique keys and stamps used by early civilizations.


5 0
3 years ago
Mutations rII1 and rII2 are known to fall into the rIIA and rIIB cistrons (genes) respectively. Cells of E. coli B are infected
viktelen [127]

Answer:

the answer is A. E. coli B

Explanation:

The multiplicity of infection (MOI) refers to the ratio between the numbers of viruses used to infect <em>E. coli</em> cells and the numbers of these <em>E. coli </em>cells. Benzer carried out several experiments in order to define the gene in regard to function. Benzer observed that <em>E. coli </em>strains with point mutations could be classified into two (2) complementary classes regarding coinfection using the restrictive strain as the host. With regard to his experiments, Benzer observed that rII1 and rII2 mutants (rapid lysis mutants) are complementary when they produce progeny after coinfect E. coli K (where neither mutant can lyse the host by itself). The rII group of mutants studied by Benzer does not produce plaques on <em>E. coli</em> K strains that carry phage λ (lysogenic for λ), but they produce plaques on <em>E. coli</em> B strains. This study showed that rIIA and rIIB are different genes and/or cistrons in the rII region.

3 0
3 years ago
How much has the greenhouse gas carbon dioxide increased in the air just in the last few years?.
Andrew [12]

<em>Answer: From 1990 to 2019, the total warming effect from greenhouse gases added by humans to the Earth's atmosphere increased by 45 percent. The warming effect associated with carbon dioxide alone increased by 36 percent.</em>

4 0
2 years ago
Other questions:
  • The process by which Prokaryotic cells divide is known as:
    7·2 answers
  • Energy is either made or lost over time. true or false, explain
    11·2 answers
  • What is the chemical made in the stomach that is not an enzyme?
    10·1 answer
  • Which organ do prokaryotes use for conjugation
    13·2 answers
  • What happens in Citric acid cycle?
    12·1 answer
  • Sexual reproduction in the parent cell will result in offspring with?
    5·1 answer
  • Natural selection story
    11·1 answer
  • The heat transfer depicted in the image is MOST likely
    7·2 answers
  • 8. What does the atomic mass represent?<br> earth science
    9·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!