1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lana [24]
3 years ago
12

Wherw is most of the energy produced in cellular respiration

Biology
1 answer:
____ [38]3 years ago
7 0

Answer:

Most of the ATP energy obtained from cellular respiration is produced in the third and final stage, the electron transport chain.

You might be interested in
Which of the following levels is the most inclusive,largest,and least specific of the choices A.phvlumB.classC.flamilyD.species
n200080 [17]
The answer is phylum
7 0
3 years ago
How does light intensity affect the rate of photosynthesis?
Mazyrski [523]
If all other resources are in adequate supply, then the light intensity will increase the rate of photosynthesis. To balance it out, other things then usually start becoming short in supply, so things often don't change.
3 0
3 years ago
Which compound is inorganic
Ksenya-84 [330]
The inorganic compound is KH2PO4. Organic compounds must contain carbon and hydrogen in them to be chemically classified as organic.
7 0
3 years ago
Read 2 more answers
SI units are based on multiples of what number?
Romashka-Z-Leto [24]
SI is a base 10 standardized system. I hope this helped and if not I highly recremend talking to your teacher or a parent.
4 0
3 years ago
for each pair of terms explain how the meanings of the terms differ. 1. diffusion and osmosis 2. active transport and passive tr
alex41 [277]
1) Diffusion and osmosis 
the diffusion of water through a semipermeable membrane is osmosis and the movement of particles from regions of higher density to regions of lower density is diffusion
2)The passive transport does not require energy and the active transport does ,this is what makes them different 
3)Endocytosis is a process for moving items that are outside of the cell into the cytoplasm of the cell. Exocytosis is a process for moving items from the cytoplasm of the cell to the outside.

5 0
4 years ago
Other questions:
  • The mismatch of DNA base pair during duplication can result in mutation true or false
    9·2 answers
  • The red shperes represent oxygen atoms and the blue spheres represent hydrogen atoms. Is this substance?
    14·2 answers
  • You find a fossil in your backyard. Twelve percent of the Carbon 14 isotope is remaining. How old is the fossil?
    15·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Jayden created a cell model using a glass bottle with a cork. he said that the cork could be opened to eliminate waste material
    5·2 answers
  • One degree of latitude on the earth's surface is equal to:
    15·1 answer
  • 4. Why did you pick this macromolecule as the most<br> important?
    6·1 answer
  • Por que se dice que los seres vivos son considerados sistema
    9·1 answer
  • In the maternity ward, Mrs. Bright and Mrs. Light share a room. When they were ready
    10·1 answer
  • This is any multicelluar living thing that obtains energy from sunlight or makes its own food
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!