no beacuse they are differnt parts of the human with different functions
Answer: Farming Hunting and Industrialization
Explanation:
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
The correct answer is d) genomic imprinting.
Explanation:
Genomic imprinting is a biological process by which specific modifications in the germ line that produce differences in the expression of the genetic material that is biochemically marked indicating its parental origin. The Prader-Willi syndrome is one of the best known and most studied examples in relation to pathologies produced by genomic imprinting. Prader-Willi syndrome is a complex genetic disease that is fundamentally neurological. Its appearance is due to a deletion of a fragment of chromosome 15 derived from the father.
Answer:
For someone who doesn't know the importance of carrying capacity, i would advice him to understand what carrying capacity mean, and then tell him that he should not overcrowd the population of animals or be part of humans overcrowding as it can destroy the ecosystem or resources.
Explanation:
This is because, carrying capacity is the population size that can conviniently live in an habitat with the available resources..
It's very important because, it will ensure that the population size that the resources can sustain can live in the environment so as to prevent degradation of the ecosystem or the environment due to increase in population size.
