1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dima020 [189]
3 years ago
6

Please help me !!!!!!!

Biology
1 answer:
chubhunter [2.5K]3 years ago
7 0
It is A because they have the same properties
You might be interested in
A horizontal line on the velocity vs. time graph indicates a constant, positive acceleration.
3241004551 [841]

The following statement is false, and it's 5 points not 50 :-)

5 0
3 years ago
Read 2 more answers
In the Punnett square, fill in the shaded boxes with the alleles of each parent. Use B for the
Gre4nikov [31]

Answer:

you gotta put the small "b" for the female and all the the box will be "Bb"

7 0
3 years ago
Read 2 more answers
What kind of lab equipment would you use to conduct a small chemical experiment
Alexandra [31]

Answer:

Beaker - A beaker is a glass container with a flat bottom and a small spout for pouring. It is used in the chemistry lab for mixing, heating, and stirring liquids. Beakers come in various sizes and are shaped like a cylinder.  

Chemistry lab beakers Beakers

Bunsen burner - The Bunsen burner is a metal tube that produces a flame from gas such as methane, propane, or butane. It is used in the lab for heating and sterilizing. The Bunsen burner is named after German chemist Robert Bunsen.  

Bunsen burner

Crucible - Crucibles are containers used for heating substances to very high temperatures. They are generally made from materials such as porcelain, nickel, and alumina.  

Erlenmeyer flask - This is a type of chemistry flask with a conical shaped body, a cylindrically shaped neck, and a flat bottom. It generally has measurement marks on the side. It is similar to a beaker, but has the cone shaped body. The cone shape reduces losses from evaporation and helps to prevent spills when stirring the liquid.  

Erlenmeyer flask

Funnel - A funnel is a pipe with a wide mouth that helps to pour substances into a container without spilling. In a chemistry lab, funnels are often used together with filters to separate a mixture.  

Funnel and flask

Gloves - Laboratory gloves are important to wear in order to protect the skin from chemical substances. Always listen to your teacher and make sure to wear gloves when performing experiments.  

Always wear gloves

Goggles - Goggles are very important when performing experiments of any kind. They can keep dangerous chemicals and other substances from damaging your eyes. Always wear your goggles in the lab!

Always wear goggles

Graduated cylinder - A tall skinny cylinder used to measure volumes. It is generally a more accurate way to measure volume than a typical beaker or flask.  

Graduated cylinder

Mortar and pestle - A mortar and pestle are used to crush and grind solids into a powder. The mortar is a bowl and the pestle is a small club-shaped tool. They are typically made from ceramic or stone.  

Mortar and pestle

Pipette - A narrow glass tube used to transfer liquids from one place to another. Pipettes sometimes are used for measurement. The accuracy of different pipettes varies widely.  

Pipette

Scoopula - A scoopula is a metal spatula-type utensil used to scoop up solids such as powders in a chemistry lab.  

Stirring rod - A skinny solid glass rod used in chemistry to mix chemicals and liquids. A stirring rod is typically about the length of a long straw and has rounded ends.  

Test tube - A test tube is a glass or plastic tube used for holding, mixing, and heating small quantities of liquid chemicals. Test tubes often have a flared top to help with pouring. They come in a variety of sizes.  

Test tube holder - A stand built for holding multiple test tubes.  

Test tube brush - A brush designed to help clean out test tubes.  

Test tube clamps - Clamps that hold test tubes while using them to heat up chemicals during a lab experiment.  

Test tubes in a holder

Thermometer - A device used for measuring the temperature of a substance.  

Triangle - A triangle made of clay pipes and wire that can withstand high temperatures. It is often used to hold a crucible.  

Wire gauze - A wire gauze is used to support a beaker or flask when heating. The wire gauze helps to spread the heat evenly.

7 0
3 years ago
Choose which tissue would line the uterine (fallopian) tubes and function as a "conveyor belt" to help move a fertilized egg tow
olchik [2.2K]
The ciliated simple columnar epithelium is a tissue that would line the uterine tubes and function as a conveyor belt to help move a fertilized egg toward the uterus. The ciliated columnar epithelium transfers mucus and constituents through cilia and is originate in the upper respiratory area the fallopian tubes, the uterus, and principal part of the spinal cord. It is the main objective of contamination for common cold illnesses. 
7 0
3 years ago
Eating faster, chewing food less thoroughly, and being more responsive to stimuli associated with food but less responsive to in
Naddika [18.5K]

Answer:

Obese

Explanation:

Obesity can occur at any age but in recent times more and more children are becoming obese. They develop an unhealthy relationship with food from a young age. Food rather than being a source of nutrition becomes just a source of sensory stimulation.

These children often chew very fast and swallow food without properly breaking it down. Thus they are not able to realize when they are full. They ignore the internal cues for hunger or fullness and keep eating to satisfy their palate. As a result, they become obese.

5 0
3 years ago
Other questions:
  • What type of neuron connects sensory and motor neurons in neural pathways?
    14·1 answer
  • What are two of the most common ways that viruses are spread?
    5·2 answers
  • I NEED HELP ASAP PLEASE !!!!
    12·1 answer
  • Please answer these questions.
    7·1 answer
  • What source of protein is best adapted for future consumption, taking these trends into consideration?
    10·1 answer
  • What is the scientific method and how do scientists use it to address environmental problems?
    6·1 answer
  • 1 How was the Flowing Water Model similar to
    11·1 answer
  • Why does the body constantly make new cells?
    8·1 answer
  • How did planetesimals form?
    9·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!