They are thus known as the "supporting cells" of the nervous system. The four main functions of glial cells are: to surround neurons and hold them in place, to supply nutrients and oxygen to neurons, to insulate one neuron from another, and to destroy and remove the carcasses of dead neurons (clean up).
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
The answer would be: Increased intracranial pressure caused by blood pooling in the head
A tumour will also apply pressure to the surrounding when growing. <span>It can also obstruct the nearby blood vessels, cause the blood or cerebral fluid to be trapped. The trapped fluid will increase the intra cranial pressure because the skull is a closed space organ. </span>
The stroma
The enzymes in the Calvin cycle are found in the stroma instead of the cell cytosol, separating the reactions.
Answer: The genetic material of the cell is duplicated during S phase of interphase just as it was with mitosis resulting in 46 chromosomes and 92 chromatids during Prophase I and Metaphase I. However, these chromosomes are not arranged in the same way as they were during mitosis.
Explanation:
