1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkasestr [34]
3 years ago
7

Carlos is analyzing the results of a recent scientific study about gravity. Scientists recorded that the experimental value of g

ravity was 10.24 m/s² and the general accepted value of gravity is 9.81 m/s². Calculate the percent error of the experimental versus accepted values of gravity. 5.01% 4.38% 2.66% 9.27%
Biology
1 answer:
Sliva [168]3 years ago
8 0

Answer:

4.38%

Explanation:

Subtract the accepted value from the experimental value.

Take the absolute value of step 1.

Divide that answer by the accepted value.

Multiply that answer by 100 and add the % symbol to express the answer as a percentage.

You might be interested in
Humming birds have specialiazed beaks that are very long and thin how does this structure of a hummingbirds beak make it more su
dangina [55]
The reason why humming birds need long beaks is to be able to get the nectar from the flowers, kind of like how we need straws to drink out of to go cups. Humming birds also have very long tongues that also help this process. Since humming birds beaks help them get the food they need, it makes them more successful in their environment. 
4 0
2 years ago
Someone help me answer these questions, I’ll give brainlyyyy :))
Gnesinka [82]
1. The organisms at lower trophic levels have more consumable energy which provides the whale with more energy that organisms at other trophic levels.
2. Agree
3. Depending on the food chain, organisms can be on multiple trophic levels. For example, lions can be both a tertiary and secondary consumer.
7 0
3 years ago
True or False. Animals vary tremendously in structure. Nevertheless, they can be categorized into a few basic body plans based o
NNADVOKAT [17]

Answer:

True

Explanation:

Animals can be categorized into 3 based on body symmetry

  • <em>Those without any body symmetry (asymmetrical)</em>
  • <em>Those with bilateral body symmetry (bilateria)</em>
  • <em>Those with radial body symmetry (Radiata)</em>

Animals can be categorized into 2 based on number of embryonic germ layer;

  • <em>Those with two layers - endoderm and ectoderm (diplobastic)</em>
  • <em>Those with three layers - mesoderm in addition to ectoderm and endoderm (triploblastic)</em>

Animals can be categorized based on presence/absence of body cavity or coelom;

  • <em>No body cavity - acoelomates</em>
  • <em>False body cavity - pseudocoelomates</em>
  • <em>True body cavity - coelomates</em>

Animals can be categorized into 2 based on characteristics of embryonic development;

  • <em>Deuterostomes</em>
  • <em>Protosomes</em>
5 0
2 years ago
What is Construction of beds and drains or ridges and furrows.​ due today pls help
Otrada [13]

Answer:

The  Construction of beds and drains or ridges and furrows is that ridge is (lb) the back of any animal; especially the upper or projecting part of the back of a quadruped while furrow is a trench cut in the soil, as when plowed in order to plant a crop.

Hope this helps :))

it is probably incorrect but i tried

4 0
3 years ago
Which lifestyle choices lead to good health? Check all that apply.
Neporo4naja [7]

Answer:

Yes, you are correct! C,D and E are correct

4 0
3 years ago
Read 2 more answers
Other questions:
  • The nurse is transferring a client from the bed to the chair. which action should the nurse take during the transfer?
    13·1 answer
  • Messenger RNA travels from the _________ to the __________ delivering information from a strand of DNA.. A) cytoplasm, cell wall
    11·1 answer
  • 30 points!!!!!!! Compare and contrast the role of a producer and a consumer in a food chain.
    12·2 answers
  • Part a which of these phases encompasses all of the stages of mitosis but no other events?
    5·1 answer
  • In the 1880s, Louis Pasteur developed a method of weakening viruses. The weakened viruses could be injected into healthy individ
    10·1 answer
  • The suffix that means "a condition" is A. –cyte. B. –ology. C. –ologist. D. –osis.
    13·1 answer
  • What is layer E pointing to
    7·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • A rock changed by heat pressure, and fluids
    10·2 answers
  • What is the relationship between ATP and mitochondria?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!