The formation of macromolecules from triose phosphate is likely anabolic and would be coupled to ATP -> ADP.
Anabolic is a group of metabolic pathways that builds compounds out of smaller building blocks. These reactions, which are often referred to as endergonic processes, demand energy. Catabolism is the breakdown component of metabolism, whereas anabolism is the building component. Typically, anabolism and biosynthesis go hand in hand. Anabolism can be seen in the growth of muscle mass and the mineralization and development of bones. Proteins are broken down into amino acids during catabolic events, as are glycogen and triglycerides into glucose and fatty acids, respectively. Fundamentally, catabolism entails disassembling complex molecules to produce energy that may be utilised by the organism. By building larger, more complex molecules from smaller, simpler ones, anabolism is the exact reverse of catabolism. The body typically stores them for later use.
Learn more about anabolic here:
brainly.com/question/16793262
#SPJ4
- <u>To science we owe dramatic changes in our </u><u>smug self-image.</u><u> </u><u>Astronomy taught </u><u>us that our earth isn't the center of the universe but merely one of billions of heavenly bodies. </u>
- <u>From </u><u>biology </u><u>we learned that we weren't specially created by God but evolved along with millions of other species. </u>
Why was agriculture the worst mistake in human History?
- Along with epidemic diseases, starvation, and malnutrition, farming also contributed to the creation of severe class distinctions.
- Hunter-gatherers rely solely on the wild plants and animals they catch each day, with little to no food stored and no concentrated food sources, such as an orchard or a herd of cows.
Was the agricultural revolution good or bad?
- Between 1700 and 1870, it is thought that both total agricultural output and output per worker increased by a factor of 2. 7 times.
- Britain's agriculture is the most productive in Europe thanks to the Agricultural Revolution, with 19th-century yields up to 80% higher than the continental average.
Learn more about Astronomy
brainly.com/question/5165144
#SPJ4
Answer:
After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is
Explanation:
1. AACGTACGATCGATGCACATGCATGGCTACGC
Complementary strand
TTGCATGCTAGCTACGTGTACGTACCGATGCG
Protein encode: NVRSMHMHGY
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
Complementary strand
GGGCCCATACGTACATGCATGCAGCATATAGC
Protein encode: PGYACTYVVY
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
Complementary strand
GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA
Protein encode: RDRAIDECLV
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
Complementary strand
AATTTGCTCGACGATCGATAAAAATTTTGGGGC
Protein encode: LNELLAIFKTP
Maybe this helps ? Please look at the picture
I wanna say it’s b but if not I’m so sorry !
