1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatuchka [14]
3 years ago
13

Describe why a person who has classic Albinism has white hair, almost translucent, and red eyes.

Biology
1 answer:
Jlenok [28]3 years ago
3 0
It is because of a defect in one of several genes that will distribute or produce melanin causing albinism. Albinism is the absence or lack of melanin.
You might be interested in
What season does the southern hemisphere experience when it is tilted away from the sun?
Vlad1618 [11]

Don't listen to the other answer (if it's still there) the answer is C. Winter

8 0
4 years ago
Evolution creates not the best solution, but the most available. What does this statement mean
Nookie1986 [14]

Answer:

It's basically saying that from the information we currently have evolution is the best idea of where we can from. Of course then Religion comes in to play. Most people believe that God made us but we can't be sure of that because we don't have certified proof ands what science wants.

6 0
3 years ago
Suggest why the efficiency of energy transfer between the phytoplankton and fish is very low
DochEvi [55]

Answer:

Some parts not eaten/indigestible ;

lost in feces /waste/excretion ;

energy loss in movement ;

heat loss in respiration

7 0
3 years ago
Drag the tiles to the correct boxes to complete the pairs.
sweet [91]

Answer:

1429 for twelve months cp ni ate a lot of battles to the song where is the love song of the song where is the love song of the song

7 0
2 years ago
A(n) ____________ is recognized by lymphocytes to be foreign and causes an immune response. A) T cell B) antigen C) antibody D)
lina2011 [118]
B) antigen, should be your answer

T cell, antibody, and histamine are all created by your body to help combat wounds or foreign substances

hope this helps
5 0
4 years ago
Read 2 more answers
Other questions:
  • Nitrogen atoms are part of the structure of some organic molecules, such as all amino acids and some modified carbohydrates. Wha
    11·1 answer
  • Which pair of organisms is most closely related to primates? amphibians and rodents ,crocodiles and amphibians ,rodents and rabb
    9·2 answers
  • The amount of energy that a food contains can be measured by vitamins. <br> a. True<br> b. False
    10·1 answer
  • The hormone that stimulates ovulation is ________.
    13·2 answers
  • A scientist discovers an organism that is multicellular with tissue organization and has cells that contain chloroplasts, a nucl
    10·1 answer
  • Which type of rock may contain fossils?
    9·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Look at the food web shown above. Which of the organisms act as producers in this ecosystem?
    10·2 answers
  • A stopped car begins moving and reaches a speed of
    12·1 answer
  • ________ slow down transpiration by _________ the stomata Question 8 options: Guard cells; closing Chloroplasts; closing Guard c
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!