During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Choaocytes are responsible for generating water currents the faciliate gas exchange and nutrition
Answer:
photosynthesis
Explanation:
If you are referring to the chemical breakdown of food in PLANTS, not humans, then your answer is photosynthesis.
Hope this helps :)
Answer:
- Trichinosis
- Bacterial endocarditis
Explanation:
Trichinosis is a parasitic infection that has as its etiological agent the nematode parasites of the genus Trichinella, and the species of greatest interest to human medicine is Trichinella spiralis. One of the first and characteristic symptoms of infection is the swelling of the eyelids, which appears around the 11th day after infection. Subsequently hemorrhages appear in the eye sclera and in the back of the eyes, eye pain and photosensitivity. Then there is the appearance of muscle pain, along with a rash and bleeding below the nails causing dark red vertical lines about 1 to 3 mm long. The pain is intense in the muscles linked to breathing, chewing and swallowing.
Bacterial endocarditis is always associated with a bacteremia that the immune system has failed to counteract. In other words, the presence of bacteria in the bloodstream, which is usually sterile, represents an important cause of bacterial endocarditis, an infection that affects the inner membrane lining the heart and heart valves, especially if they already have a disorder. The disease sets in when bacteria from various parts of the body - from the mouth mainly, but also from the skin, intestines, respiratory tract, and urinary tract - are carried through the bloodstream to a heart valve or other damaged endocardial area where fix it. Among the many symptoms, indicative of the presence of this disease in the body are thin dark red vertical lines about 1 to 3 mm long in the nails.