1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
polet [3.4K]
3 years ago
12

Overview plant reproduction

Biology
1 answer:
Norma-Jean [14]3 years ago
7 0

Answer:

dunno wut you meam

Explanation:

do I write how plants are remade?

You might be interested in
Which of the following units that can only describe scalar quantities ? A. METERS B. GRAMS C. SECONDS D. MILES PER HOUR?
Zigmanuir [339]

Answer:

gram and seconds

Explanation:

5 0
3 years ago
Read 2 more answers
What is the term for the protective wall that helps bacteria survive unfavorable conditions? A. endospore B. botulism C. aerobic
VARVARA [1.3K]

Answer:

The answer is A

Explanation:

5 0
4 years ago
2. The peripheral nervous system is made up of two systems; the _____________ nervous system controls muscle movement and the __
fredd [130]

The peripheral nervous system is made up of two systems; the somatic nervous system controls muscle movement and the autonomic nervous system connects with internal organs.
8 0
3 years ago
How many chromatids does a human somatic cell contain after interphase and just prior to mitosis?.
rodikova [14]

Answer:

Explanation:

92

4 0
2 years ago
When plants wilt they're soft stems and leaves begin to drop what is going on inside the plant cells that causes the plant to dr
Nat2105 [25]
The cell membranes begin to come apart when there is insufficient water around the cells. The cytoplasm of the cells becomes more concentrated, which slowly poisons the cells. The cell walls become brittle as they dry out, and some of them collapse. The central vacuoles in the cells lose water and can no longer help support the cells.


The central vacuoles in the cells lose water and can no longer help support the cells
3 0
3 years ago
Other questions:
  • The following table shows the distance from the sun of some unknown planets of equal mass.
    9·2 answers
  • New sequencing techniques reveal that a child is heterozygous for a new mutation. this mutation appears in all of the cells test
    7·1 answer
  • Illustrate the factors that allow the aquatic pyramid of biomass to be inverted.
    6·2 answers
  • I need help with this problem
    7·1 answer
  • The various parts of the endomembrane system serve different functions in the cell. In this activity, you will identify the role
    15·1 answer
  • I need help guys on this question
    8·2 answers
  • I need help with this thanks (1 question)
    12·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • When gases trap heat in the atmosphere causing the temperature to rise this is called the greenhouse effect.
    8·2 answers
  • The liver and pancreas are both human body organs. Which of the following correctly compares the two organs?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!