1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
My name is Ann [436]
3 years ago
14

How do axial filaments differ from regular bacterial flagella?

Biology
1 answer:
Elena L [17]3 years ago
3 0

Answer: D

Explanation: the axial filament is madeup of hundreds of fimbrils. It is an organ of locomotion in organisms. It is located between the cell membrane and the outer membrane thereby giving the organism the ability to make a twisting motion. Example of organism that possess axial filaments is the spirochetes

You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
A : a fertilized egg
UNO [17]

Answer:

blastocyst means

C : a mass of specialized eggs

it helps in the development of cells in the egg.

3 0
3 years ago
. Which one of the following cells would have the greatest surface-to-volume ratio?
pochemuha
I think it's ostrich egg
6 0
3 years ago
Which nucleotide is in RNA but not in DNA?
kherson [118]

Answer: Uracil

Explanation:

4 0
3 years ago
Read 2 more answers
Gregor Mendel was the first scientist to use statistics to analyze scientific data. Before Mendel’s experiments, scientists beli
strojnjashka [21]
I think this is an theory changing because a new scientific method was developed. They used what Mendel had learned to test the hypothesis themselves and discovered that he was right.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which seedless plants have been used to treat burns ??
    12·1 answer
  • The plasma membrane is.... question 3 options:
    5·1 answer
  • in what way does agriculture, lumbering, housing, industrial development, and highway construction affect erosion
    5·1 answer
  • SHERIFF. Nothing here but kitchen things. (The County Attorney, after again looking around the kitchen, opens the door of a cupb
    11·2 answers
  • What happens when an oceanic and a continental plate collide?
    13·2 answers
  • Answer these questions please
    12·1 answer
  • Why would damage to the nervous tissue in the spinal cord lead to paralysis?
    15·2 answers
  • Which is a completely hereditary trait?
    11·2 answers
  • What are the two main reactions in photosynthesis called?
    10·1 answer
  • What did the miller- Urey experiment demonstrate?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!