1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
snow_tiger [21]
3 years ago
12

Minerals containing a useful substance are referred to as a. Gems c. Veins b. Ores d. Quartz

Biology
2 answers:
miv72 [106K]3 years ago
5 0
The answer ores that's what i got and it was correct. hope this helped 
Kruka [31]3 years ago
4 0
  • <em>Minerals containing a useful substance are referred to as ores. </em>
  • Ores are basically minerals with elements that are economically important to us and thus, the ores are mined to extract the useful substances.
  • More commonly the important elements extracted from these ores are the metals such as copper, iron, lead, zinc, and nickel.
  • The metals can either be present in the ores as oxides, silicates, sulphides or in their native state.
You might be interested in
Which of these requires a host cell to copy its genetic material and protein coat?
svet-max [94.6K]

The virus' DNA becomes a part of the host cell's DNA, and every time the host cell copies and divides, it also copies viral DNA. The viral DNA may remain inactive (a provirus) for a long time, but it can become active when it frees itself from the host's chromosome, which triggers the lytic cycle.

I forget which one is the virus' DNA


3 0
3 years ago
Read 2 more answers
Organisms that brake down molecules to generate energy
Molodets [167]
Bacteria !!!!!!!!!!!!!!!!!!!!!
3 0
3 years ago
Read 2 more answers
Vegetarianism is often cited as a partial solution to the growing problem of deforestation and other types of habitat destructio
PilotLPTM [1.2K]

Answer:

Option B. is correct

Explanation:

Vegetarianism is the practice of abstaining from by-products of animal slaughter and the consumption of meat. Vegetarianism is often cited as a partial solution to the growing problem of deforestation and other types of habitat destruction as the human population continues to grow. The reason for this is more people can be fed using less agricultural land because vegetarians eat at a lower trophic level.

Option B. is correct

3 0
2 years ago
(PLEASE HURRY IM TIMED)The leaf shown has a color pattern of green and white
sdas [7]
C. The green part, because it contains chlorophyll
3 0
2 years ago
What cells carry nutrients from food to the rest of the cells in the body
Triss [41]

Answer:

the arteries and veins

5 0
3 years ago
Other questions:
  • Since hemoglobin is attracted more to carbon monoxide than it is to oxygen, what is likely to happen to a person if he breathes
    6·2 answers
  • How is erosion different than weathering?
    6·1 answer
  • Which stage of a river development is characterized by flat floodplains
    12·1 answer
  • Use bedrock in a sentence.
    7·1 answer
  • In living cells, what is the energy carrier that fuels most kinds of cellular work? glucose ATP ADP
    7·1 answer
  • nitrogen is an essential nutrition for plant growth but farmers who cultivate pulse grow crops like green gram Bengal gram exetr
    15·1 answer
  • PBR322, where pBR stands for ................​
    8·1 answer
  • Changes in state of matter
    7·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Suppose that one allele for an enzyme codes for a form that is active from pH 6.2 to pH 6.8 and another allele for this enzyme c
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!