1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
algol [13]
3 years ago
11

How do humans affect climate change ?

Biology
2 answers:
masya89 [10]3 years ago
7 0

Answer:

By using too much Fossil fuels like coal and oil, gas.

VARVARA [1.3K]3 years ago
5 0
By polluting the environment with toxic waste, e.g. trash on the shores. humans also cut down trees reducing the oxygen produced
You might be interested in
Where does a fertilized egg spend most of its time?
dybincka [34]

Answer:

A.

Explanation:

hope that helped :))

7 0
3 years ago
Read 2 more answers
The earliest (that is, the oldest) stone tools are referred to as:
Rina8888 [55]

Answer:

The correct option is : a. Oldowan

Explanation:

The Oldowan or Mode I tools are the simply earliest or the oldest recognizable tools, preserved in the archaeological records.

The oldest Oldowan tool is dated about 2.6 million years ago and was found in Gona, Ethiopia. These tools were used in the Lower Paleolithic period, about 2.6 million years ago until 1.7 million years ago. These tools were used in Africa, Middle East, South Asia and Europe, by the early humans.

5 0
4 years ago
4. Enzymes are (choose one) a. Lipids c. Proteins b. Carbohydrates d. Nucleic acids
hodyreva [135]
Enzymes are a type of protein
3 0
4 years ago
Read 2 more answers
Humans autosomal cells have two copies each of 23 unique chromosomes. Match each of the following cell division events and cell
zvonat [6]

Answer:

Please see below    

Explanation:

The number of chromatids have been stated with the respective event when it occurs in that particular number in the following way:  

<u>23 chromatids</u>

primary oocyte arrested prior to ovulation  

spermatozoa    

<u />

<u>46 chromatids</u>

oogonium prior to S phase  

<u>92 chromatids</u>

secondary polar body

7 0
3 years ago
Which phrase best describes a semidiurnal tide pattern?
Sliva [168]

Answer:A

Explanation:

3 0
3 years ago
Other questions:
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • If a tornado destroys a deciduous forest, what kind of succession follows?
    10·2 answers
  • Sunlight exposure has stronger effect on skin cancer risk in fair-skinned humans than in individuals with darker skin. This is a
    15·1 answer
  • Suppose a person is homozygous recessive for a
    14·1 answer
  • Before 1800, most peppered moths in England were light–colored. During the Industrial Revolution, soot and industrial wastes dar
    8·1 answer
  • HELP 20MINUTES LEFT!
    8·1 answer
  • When a peptide hormone reaches its target cell, which event happens next?
    11·1 answer
  • What’s the frontal lobes in the brain?
    6·2 answers
  • HELP PLEAASEEE
    14·1 answer
  • 4. (a) Can a cell wall be seen in frog blood cells?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!