1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ira Lisetskai [31]
3 years ago
9

How do the structures observed under magnification help the organism carry out basic functions of life? Write your findings in t

he space provided.
Biology
1 answer:
Tpy6a [65]3 years ago
4 0

Answer:

io

Explanation:

You might be interested in
True or false:Meiosis takes place when it is time to replace old cell.Explain
Sveta_85 [38]

Answer:

False

Explanation:

Mitosis is the process of replacing damaged and old cells.

7 0
3 years ago
What chemicals regulate the cell cycle how do they work?
Molodets [167]
Cyclins are the chemicals that regulate the cell cycle. Cyclins work by regulating the timing of the cell cycle in eukaryotic cell. Cyclins activates cyclin dependent kinases (CDKs) (an enzyme that works by adding <span>negatively charged phosphate groups to other molecules in a process called phosphorylation) by binding to it to form a cyclin-Cdk complex. This complex then functions by acting as a signal to the cell to move to the next cell cycle phase. At the end of the event, the cyclin is degraded, Cdk is deactivated, therefore signaling exit from a specific phase.</span>


5 0
3 years ago
Read 2 more answers
Breathing involves the movement of diaphragm and Rib cage<br><br><br><br>true or false​
Elza [17]

Answer:

<h2><em><u>True</u></em><em><u> </u></em></h2>

Explanation:

<u>It's</u><u> </u><u>a</u><u> </u><u>true</u><u> </u><u>statement</u><u> </u><u>as</u><u>,</u>

  • When we inhale the diaphragm moves downwards and the rib cage moves upwards and outwards to let enter the outside air containing oxygen come in.
  • While we exhale the diaphragm comes to its position and the rib cage move downwards and inwards to let out the inside carbon-dioxide and other games out.

<u>Hence</u><u>,</u><u> </u><u>we</u><u> </u><u>can</u><u> </u><u>conclude that</u><u> </u><u>breathing involves the movement of diaphragm and Rib cage</u><u>.</u>

4 0
3 years ago
Fifty-five-year-old Hansen wants to have a child with his new bride. You express your concerns and explain to your friend that b
bazaltina [42]

Answer:

disability

Explanation:

The answer is disability

8 0
2 years ago
g Electron flow down the electron-transport chain leads to the transport of proteins: Group of answer choices from the matrix to
guajiro [1.7K]

Answer:

from the intermembrane space to the matrix

Explanation:

In the electron transport chain (ETC), electrons flow from one protein complex to another. However, as this electrons are transfered, protons (H+) is built up from the intermembrane space of the mitochondria to the mitochondrial matrix.

Hence, according to this question, a proton gradient is formed when hydrogen ions (H+) are moving from the intermembrane space to the matrix of the mitochondrial.

5 0
3 years ago
Other questions:
  • Which two hypothesis can be supported with quantitative data?
    14·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • ______________ is the process of translating a message received into understandable language or symbols.
    7·2 answers
  • Text about amoebas pleasee
    13·1 answer
  • Which statement describes the relationship between a gene and an allele?
    13·2 answers
  • What two things should you put for each observation
    10·1 answer
  • Both mitosis and meiosis begin with a diploid cell that contains replicated chromosomes. What are the main differences between t
    14·2 answers
  • Please help with this question
    6·1 answer
  • Can you guys help me???<br><br> Why does dna polymerase can't synthesize the ends of linear dna?
    15·1 answer
  • Why are X-linked traits more common than Y-linked traits?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!