1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jeka94
3 years ago
9

What chemical involved in the processes of photosynthesis has the greatest number of atoms per molecule? F carbon dioxide G gluc

ose H Oxygen J Water
Biology
1 answer:
SOVA2 [1]3 years ago
5 0

Answer: The correct answer is Glucose.

The chemical formula of the given molecules are-

Carbon dioxide is CO₂, which means that it contains 2 oxygen and 1 carbon atom and therefore 3 atoms per molecule.

Glucose- C₆H₁₂O₆, which means that it contains 6 carbon, 12 hydrogen, and 6 oxygen atoms. Thus, total atoms are 24 per molecule.

Oxygen- O₂, which means that it contains 2 atoms of oxygen.

Water- H₂O, which means that it contains 2 hydrogen and 1 oxygen atom and therefore 3 atoms per molecule.

Thus, glucose has greatest number of atoms per molecule.

You might be interested in
In landlocked lakes, water is discharged primarily through _____. precipitation evaporation groundwater seepage rivers and strea
zloy xaker [14]
The correct answer is evaporation. Hope this helps
4 0
4 years ago
Read 2 more answers
Is the ganglia in the PNS or CNS
tatuchka [14]
Ganglia is in the PNS.
6 0
4 years ago
Read 2 more answers
HELP QUICK PLEASE <br><br> Select the hotspot that shows metaphase.
Radda [10]
Top right one, metaphase is where the chromosomes are lined up in the middle (metaphase=middle)
7 0
3 years ago
What is the ability of an organism to survive dependent on abiotic and biotic factors that affect it?
elena55 [62]

Answer: C - Tolerance

Explanation:

6 0
3 years ago
What volume of water is reabsorbed by the colon each day?
Yanka [14]
Over a liter of water is reabsorbed by the colon
4 0
3 years ago
Other questions:
  • How does the ring of fire relate to the location of earthquake?
    12·1 answer
  • When a tautomeric shift occurs, the resulting nulceotide is a(n) __________ of the nucleotide prior to the shift?
    11·1 answer
  • Explain what distinguishes primary and secondary consumers
    7·2 answers
  • Which of the following statements is true?
    8·1 answer
  • What is the similarity between trenches and subduction zones?
    15·1 answer
  • Which of the following statements about the small intestine is false?A. The inside of the small intestine is called the lumen.B.
    5·1 answer
  • Insert word in for the line (the given statements are definitions of the word):
    8·2 answers
  • Which of these is NOT an interaction between a plant's root and shoot systems?
    6·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Nick is smiling even though he does not feel happy. After a short time he feels happier. The best explanation for Nick's change
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!