1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irakobra [83]
4 years ago
8

A selectively permeable membrane separates two solutions. Water is able to pass through this membrane; however, sucrose (a disac

charide) and glucose (a monosaccharide) cannot pass. The membrane separates a 0.2-molar sucrose solution from a 0.2-molar glucose solution. With time, how will the solutions change?a. Nothing happens because the two solutions are isotonic to one another.
b. Water enters the sucrose solution because the sucrose molecule is a disaccharide and thus larger than the monosaccharide glucose.
c. Water leaves the sucrose solution because the sucrose molecule is a disaccharide and thus larger than the monosaccharide glucose.
d. The sucrose solution is hypertonic and will gain water because the total mass of sucrose is greater than that of glucose.
e. After the sucrose dissociates to two monosaccharides, water will be osmostically drawn to that side of the membrane.
Biology
1 answer:
NNADVOKAT [17]4 years ago
3 0

Answer:

a. Nothing happens because the two solutions are isotonic to one another.

Explanation:

Two solutions of the same molarity are separated from each other by a membrane that allows water molecules but not the glucose or sucrose to move across it. Movement of water across the selectively permeable membrane occurs only when two solutions have different concentrations of solutes. In that case, water moves from a hypotonic solution towards a hypertonic solution. Since both sucrose and glucose solutions have the same tonicity, there would not be any change in the solution.

You might be interested in
Why might a farmer choose to install wind turbines rather than solar panels?
leva [86]

C. Wind turbines are more reliable then solar cells.

7 0
4 years ago
Read 2 more answers
What is one difference between the rabies virus and the influenza virus
Lerok [7]
  The rabies virus spread through animals and cause deadly effects. The influenza virus is easily passed between humans and is easily treatable and much less deadly.


5 0
3 years ago
how does the fetus excrete metabolic waste? a.)the umbilical cord carries the metabolic waste from the fetus to the placenta, wh
True [87]
Pretty sure its a.) the umbilical cord carries the metabolic waste from the fetus to the placenta where it diffuses into the maternal blood.

Bc metabolic waste just goes from the umbilical cord to the mothers blood
8 0
3 years ago
Read 2 more answers
In which of the following ways are tRNA and mRNA SIMILAR
solniwko [45]
Simple explanation: they both attach to amino acids.
7 0
4 years ago
Phosphofructokinase catalyzes the phosphorylation of fructose 6‑phosphate to fructose 1,6‑bisphosphate in glycolysis. Fructose 1
Airida [17]

Answer:

Fructose 2,6‑bisphosphate (F26BP) activates phosphofructokinase‑1 (PFK -1) and inhibits fructose 1,6‑bisphosphatase (FBPase)

Explanation:

Fructose 2,6‑bisphosphate (F26BP) is a metabolite that is produced with an increase in glucose, hence increasing the availability of fructose-6-phosphate. With, the increased concentration of F26BP, it increases the affinity of PFK- 1 to fructose-6-phosphate, thereby activating glycolysis which enhances the catabolism of glucose. In contrast, F26BP inhibits the activity of  fructose 1,6‑bisphosphatase (FBPase), hence inhibiting gluconeogenesis. Gluconeogenesis (formation of glucose) will not be need since there is the presence of glucose in the system.

In summary, fructose 2,6‑bisphosphate (F26BP) reciprocally controls the enzymatic activity of  phosphofructokinase‑1 (PFK -1) and fructose 1,6‑bisphosphatase (FBPase); it inhibits gluconeogenesis by inhibiting the enzyme, FBPase and activates glycolysis by activating the enzyme PFk -1

7 0
4 years ago
Other questions:
  • Which correctly identifies the composition of an oxygen atom ?
    10·1 answer
  • You have isolated an aerobic gram-positive, endospore-forming bacterium that grows well on nutrient agar. To which of the follow
    11·1 answer
  • Where is chicken pox most common??
    5·2 answers
  • What process is necessary for the inherited traits of an organism to be passed along by sexual reproduction and why?
    11·1 answer
  • What could a bird do to survive if the only food item available in the habitat was beans, yet it's beak was not effective in gat
    5·1 answer
  • How might the nervous system effect the vascular system
    13·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • *
    7·1 answer
  • True or False: If a dominant allele is present, the recessive trait will not be expressed
    7·1 answer
  • Distinguish between a mixture and solution
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!