1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ehidna [41]
3 years ago
15

Martha has a widow's peak (dominant trait) and attached earlobes (recessive trait). Martha's dad had a straight hairline and una

ttached earlobes. If Martha marries a man that is heterozygous for both traits, what is the probability that they will have a child with a widow's peak and attached earlobes?1/163/81/41/23/4
Biology
1 answer:
Readme [11.4K]3 years ago
8 0

Answer:

3/8

Explanation:

Martha has a widow's peak (dominant trait) and attached earlobes (recessive trait).

Martha's dad had a straight hairline (ww) and unattached earlobes (Ee, because she has the recessive alleles ee and both parents give us one allele).

This tells you that martha has a mother with at least one of both alleles dominant for widow peak and at least one recesive allele of attached earlobes

So, martha's alleles are: Ww and ee.

If she marries a man that is heterozygous for both traits (Ww and Ee) the probabilitys are

Ww Ee x Ww ee: WWEe, WwEe, wWee, and wwee

You might be interested in
What would happen to the original rabbit population if you introduced another type of rabbit, one that could run faster and esca
Sonbull [250]

Answer: the new population would die off first

Explanation:

4 0
3 years ago
Read 2 more answers
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
2 years ago
A substance that can protect a person's cells from being damaged or destroyed by certain harmful factors is a (an) ________.
dmitriy555 [2]
Cell membrane or in planet cells: cell wall AND membrane
4 0
3 years ago
What type of element is present in a supernova gas cloud that is not present in a smaller star like our sun?
sergey [27]
It’s either carbon or hydrogen but I would definitely go with hydrogen
5 0
3 years ago
Which best describes Darwin's studies that led to the theory of evolution?​
const2013 [10]
Do you have a picture of the question?


If not the Darwinism is a theory of Biloxi all evolution developed by the English naturalist Charles Darwin and others stating that all species of organism arise and develop through the natural selection of small, inherited variations that increase the individual’s ability to compete, survive and reproduce
6 0
3 years ago
Read 2 more answers
Other questions:
  • What type of organism are frogs in example of?
    12·2 answers
  • A protein has altered funtion as a result of a single amino acid substition in the polypeptide (protein). this change resulted f
    13·1 answer
  • A 13-year-old girl is being evaluated for possible crohn's disease. the nurse expects to prepare her for which diagnostic study?
    11·1 answer
  • Which organelles are needed to bring in or move out materials from the cell
    5·1 answer
  • All matter is NOT composed of __________. protons neutrons sodium electrons
    8·2 answers
  • Role of a student in protecting environment
    10·1 answer
  • If transpiration stopped completely, how would a plant's homeostasis first be affected?
    10·1 answer
  • What can cause DNA to mutate?
    12·1 answer
  • Which types of organisms typically reproduce by binary fission
    14·2 answers
  • Which two elements are likely to share electrons?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!