All categories

3 years ago

Which details did you include in your description

Biology

2 answers:

Kaylis [27]3 years ago

8 0

Answer:

Carbon dioxide and water are combined in a series of reactions.
Sunlight provides energy for the reactions.
The end result of photosynthesis is the production of sugars (glucose, a food) and oxygen (a gas).

Explanation:

Photosynthesis is the process in which autotrophic beings, such as cyanobacteria, algae and plants produce their organic matter, that is, they manage to produce their own food. It is from this process that these living beings will generate the sugars and amino acids that become proteins, lipids, vitamins.

The photosynthesis process includes the elements: sunlight (provides energy), carbon dioxide and water. When these elements are combined, glucose and oxygen are produced.

In summary, we can state that:

Carbon dioxide and water are combined in a series of reactions.
Sunlight provides energy for the reactions.
The end result of photosynthesis is the production of sugars (glucose, a food) and oxygen (a gas).

kumpel [21]3 years ago

4 0

Answer: carbon dioxide and water are combined in a series of reactions, sunligh provides energy for the reactions, the end result of photosynthesis is the production of sugars (glucose, a food) and oxygen (a gas)

Explanation: organisms use both oxygen to turn glucose into carbon dioxide, water and energy in the form of ATP.

You might be interested in

A child collected data about the motion of a toy train on a straight track and recorded the data in the graph below witch of the

Olenka [21]

I think you forgot something to put on

8 0

2 years ago

Why is kevin gates rich

Rashid [163]

Answer:

Cause he's a celebrity?

Explanation:

Above

5 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

The most controversial technique of genetic engineering is

fenix001 [56]

Cloning. you're welcome.

4 0

3 years ago

Which directional terms best describe the location of the sternum in relation to the vertebral column? in the axial region of th

liraira [26]

Answer:

Explanation:

In anatomical terminology there are several words to indicate the position or part of the body that is being mentioned in a more specific and precise way, a group of these terms are called directional terms, they focus on the position of a specific part, one of the words in this group is "anterior" it basically means "in front of". The sternum is in front of the vertebral column.

3 0

3 years ago

Read 2 more answers