1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anastasy [175]
3 years ago
13

One coiled spring is shown in the diagram.

Biology
2 answers:
Bas_tet [7]3 years ago
7 0

Answer:

Backbone

Explanation:

blondinia [14]3 years ago
6 0

Answer:

Spring can be considered as backbone of the DNA.(as picture is missing there)

Explanation:

In DNA double helical model two main structure are there-

1- Backbone consist of phosphate group and the pentose sugar. It is like two vertical columns of a ladder. In helical structure two complementary stands are there one is 3' to 5' and another one is 5' to 3'.

2- Nitrogenous bases are like horizontal bars of ladder attaching two vertical strands. There are 4 kinds of nitrogenous base ADENINE , THYMINE , GUANINE , and CYTOSINE. One more nitrogenous base URACIL is also there but found in RNA not in DNA.

DNA is made of nucleotide and a nucleotide molecule is made of pentose sugar(deoxyribose) ,phosphate group and nitrogenous base.

You might be interested in
(50 points and brainliest)
SashulF [63]

Answer:

Intraspecific competition

Explanation:

Intraspecific competition occurs between members of the same species. For example, two male birds of the same species might compete for mates in the same area.

4 0
3 years ago
Read 2 more answers
Describe the events of each stage of mitosis
seraphim [82]
Mitosis consists of four basic phases: prophase, metaphase, anaphase, and telophase. ... These phases occur in strict sequential order, and cytokinesis - the process of dividing the cell contents to make two new cells - starts in anaphase or telophase. Stages of mitosis: prophase, metaphase, anaphase, telophase.
6 0
4 years ago
Im suffering y’all. I just need help bro
Yuki888 [10]
The answer is C.
the first number will never go over 10 or under 1 so it would be 7.620
3 0
3 years ago
Read 2 more answers
When the nurse researcher conducts an electronic literature search, the search yields more than 7000 citations for the topic. th
Sauron [17]
The correct answer is "the keywords were not sufficiently narrowed".
In this example, the literature research yielded a great and unmanageable number of citations. It is practically impossible to read all these citations and most probably some of these citations are not relevant to what the nurse researcher is looking for. Therefore, this literature research needs to be conducted again, by narrowing down the focus using more precise terms. 
4 0
4 years ago
Due in 25 minutes. help
antoniya [11.8K]

Answer:

1. Greenhouses are used to grow plants, such as tomatoes and tropical flowers. A greenhouse stays warm inside, even during the winter. In the daytime, sunlight shines into the greenhouse and warms the plants and air inside. At nighttime, it's colder outside, but the greenhouse stays pretty warm inside.

2. It might seem like a minor difference: It's the energy itself that is re-radiated and prevented from escaping in the atmospheric greenhouse, while in an actual greenhouse it's the air that has been warmed by the energy that is prevented from escaping.

3. A greenhouse is a building with glass walls and a glass roof. ... The greenhouse effect works much the same way on Earth. Gases in the atmosphere, such as carbon dioxide, trap heat just like the glass roof of a greenhouse. These heat-trapping gases are called greenhouse gases.

4. The purpose of a greenhouse is to shield crops from excess cold or heat and unwanted pests. A greenhouse makes it possible to grow certain types of crops year round, and fruits, tobacco plants, vegetables, and flowers are what a greenhouse most commonly grows.Nov 15, 2016

Explanation:

I hope this helps :)

7 0
3 years ago
Other questions:
  • Which of the following carbon compounds stores and transmits hereditary information?
    9·1 answer
  • What is the term used for a farmer growing crops but using it for self gain?
    8·2 answers
  • 1. describe 2 benefits and 2 drawbacks there might be for animal cells ( including humans) to make their own food through photos
    12·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • One of the most unusual aspects of virus particles is the absence of all organelles and other smaller structures. Whereas cells
    14·2 answers
  • Which of the following pairs of terms is mismatched?
    5·1 answer
  • The exact location within the chloroplast in which the dark phase of photosynthesis occurs​
    13·2 answers
  • Lasers can be used to guide wood through table saws. <br> True<br> False
    15·1 answer
  • How will a wind blowing to the south in the Northern Hemisphere be affected
    9·1 answer
  • Proteins that assist in the movement of substances across membranes can be classified into two types based on how they move solu
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!