1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex73 [517]
3 years ago
8

Why is the pairing of bases during replication essential for the transmission of inherited traits?

Biology
1 answer:
____ [38]3 years ago
8 0
During replication, molecule DNA is copied into new identical molecule DNA. According to the complementary rule, adenine will always bind thymine and vice versa while guanine will always bind cytosine and vice versa. So, if the pairing of bases is perfect during the replication, the offspring will have the same sequence of bases in molecule DNA their parents have.
You might be interested in
Which plant activities are directed by hormones? (select all that apply)
natita [175]

Answer:

All of the activities are directed by plant hormone

5 0
2 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
magine you are trying to determine the phenotypic ratio of hair color. Brown (B) hair color is the dominant trait and blonde (b)
skad [1K]

Answer:

1:1 (brown:blonde)

Explanation:

Brown hair color (B) is dominant over blonde hair color (b).

Heterozygous parent will have the genotype Bb

Homozygous recessive parent will have the genotype bb.

Crossing hetezygous parent with homozygous recessive parent:

Bb   x   bb

Progeny: Bb, Bb, bb, and bb.

2 Bb brown hair

2 bb blonde hair

Phenotypic ratio = 1:1 (brown:blonde)

The correct answer is  1:1 (brown:blonde).

8 0
3 years ago
Ailani age 3 is lactose intolerant and unable to drink milk or to eat dairy products. what nutrients is most likely deficient in
svetlana [45]
Calcium. Almonds, broccoli, oranges, kale
8 0
4 years ago
Read 2 more answers
What similarities do mitochondria and choroplasts share
EleoNora [17]
<span>also supports and protects and shapes a plant cell and also regulates what moves into the cell can help support the entire plant. What similarities do the mitochondria and chloroplasts share? Both membrane bound organelles have their own DNA and help make energy available to the cell.</span>
8 0
3 years ago
Other questions:
  • Which structure receives food directly from the stomach, where it is mixed with strong digestive juices from the liver and pancr
    15·1 answer
  • The ultimate source of energy that drives severe weather is
    7·2 answers
  • Please help match!! :)
    15·1 answer
  • How are 96% human dna found in gorilla dna?
    12·1 answer
  • While at the shore, you and your friend maria find a nest containing the fossilized remains of an animal. the nest, covered with
    10·1 answer
  • What is the process of exchanging oxygen and carbon dioxide called?
    7·2 answers
  • As a seedling , the strangler fig and host tree have a relationship that is described as commensalism . Why is commensalism a go
    13·1 answer
  • List 5 anthropogenic climate change causes
    12·1 answer
  • Which of the following correctly describes the process of DNA replication in the lagging strand?
    15·2 answers
  • List two functions of the cell wall in plant cells.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!