1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svlad2 [7]
3 years ago
15

The sodium-potassium pump in animal cells requires cytoplasmic ATP to pump ions across the plasma membrane. When the proteins of

the pump are first synthesized in the rough ER, what side of the ER membrane will the ATP binding site be on? A. It will be on the cytoplasmic side of the ER. B. It will be on the side facing the interior of the ER. C. It could be facing in either direction because the orientation of proteins is scrambled in the Golgi apparatus. D. It doesn't matter, because the pump Is not active in the ER. E. Not enough Information is provided to answer this question.
Biology
2 answers:
VikaD [51]3 years ago
8 0

Answer:

A

Explanation:

The Endoplasmic reticulum is now responsible for pumping cytoplasmic ATP across the plasma membrane. the Proteins could be send to the Golgi apparatus for packaging and from there to the nucleus. The ER is responsible for synthesizing these proteins because of its proximity to the nucleus

mina [271]3 years ago
5 0

Answer: The correct answer is option A

It will be on the cytoplasmic side of the ER.

Explanation: Active transport is an energy requiring process,it involves the pumping of molecules and ions accross membranes against a concentration gradient.

The sodium-potassium is an active transport pump/system that exchanges sodium ion for potassium ion.

In the presence of cytoplasmic Adenosine Triphosphate,the proteins of the sodium-potassium pump are synthesized in the rough endoplasmic reticulum,the Adenosine Triphosphate binds to the cytoplasmic side of the endoplasmic reticulum moving sodium and potassium ion against large concentration gradients.The sodium-potassium pump moves two(2) potassium into the cell where potassium levels are high (intracellular) and pumps three(3) sodium out of the cell and into the extracellular fluid compartment.

You might be interested in
A hypothesis is a possible explanation that can be tested by observation or experiment
Len [333]
A hypothesis<span> is an idea that </span>can be tested<span> by an </span>experiment<span>-These ideas are based upon a person's </span>observations and<span> previous knowledge or experience. </span>
4 0
3 years ago
Read 2 more answers
Some bacteria live in the roots of plants like soybeans and peas. What is the role of these bacteria in the nitrogen cycle.
love history [14]

Answer:The nitrogen present in the soil is not directly used by the bacteria. It can be used only when the nitrogen is converted into usable form. These bacteria convert  atmospheric nitrogen into ammonia, then nitrite which is then converted into nitrate. This nitrate is used by the roots of the plants like soybeans and peas. This is the role of bacteria present in the roots of the plant to convert atmospheric nitrogen into usable form that can be used by plants.

Explanation:

3 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Two parents who do not have sickle cell anemia have a child that has the disease. The parents are both:_______
Mars2501 [29]

Answer:D

Explanation:

Both parent are Heterozygous for the sickle cell allele.

Both parent have sickle cell trait in which the both posses one abnormal allele of the hemoglobin beta gene (AS heterozygous genotype)

When two AS parents mate, probability of giving birth to a sickle cell anemia child is 1/4

AS + AS= AA, AS, AS, SS

6 0
3 years ago
How many yards in 15 feet
boyakko [2]

Answer:

5 Yard

Explanation:

6 0
3 years ago
Other questions:
  • Why is all stem cell research good?
    10·1 answer
  • Pee wee herman's shoulders and waist are almost exactly the same width, so he is an example of which body type?
    7·1 answer
  • Is a heart is made up of one type of cells true or false
    14·1 answer
  • Where does a new plant get the energy it needs to grow when it first germinates?
    12·1 answer
  • Which of the following statements is true? Choose one: A. Bacterial species use a limited number of nutrient sources. B. All bac
    11·1 answer
  • HELPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP
    13·2 answers
  • How do birds beaks get longer
    6·1 answer
  • Pls help it’s due in a hour!!
    6·1 answer
  • Explain how the theory of evolution is supported. (list and describe each evidence)
    13·2 answers
  • If an electrically neutral atom contains 16 protons, it must also contains 16 neutrons
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!