Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
The nitrogen cycle provides nitrogen to the ecosystem from the atmosphere, ground and oceans. Nitrogen is an important component of complex molecules such as amino acids and nucleotides, which lead to the creation of proteins and DNA, the building blocks of all life .
Answer:
Internal heat
Explanation:
I did this in the 4th grade
The warmth of the water and the salt acts as anti biotic for swelling in the mouth. it takes out the infection which calms down the swelling
