Answer:True
Explanation:Basically thymine diamers are mismatched pairs (thymine binds with another thymine instead of binding with adenine) and may lead to unwanted results so the mismatching can be repaired by using two methods which are as follows :
1-the PRE enzyme activated by blue light breaks the thymine diamer and some of the surrounding bonds the strand is cut and DNA polymerase then restores the normal base pairing
2-UVR system breaks dimer creating a gap when a gap is created and the molecules appear unpaired it is filled by proof readers hence restoring normal base pairing.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
The step of the cellular respiration pathway that can take place in the absence of O2 is glycolysis, glycolysis is an anaerobic that’s mean it’s does not require oxygen O2
The answer is: Glycolysis
Answer: A) They are the site of protein synthesis.
Explanation:
Ribosomes are small round organelles attached to the endoplasmic reticulum in cells, and serve as site of protein synthesis. This is possible because the transfer RNA assembles amino acids to form polypeptide chains right in the ribosomes.
Thus, ribosomes are site of protein synthesis
En las arqueas, generalmente se encuentra en la forma L-isomérica, mientras que las bacterias y eucariotas tienen la forma D-isomérica. Una segunda diferencia es la presencia de un enlace éter en oposición a los lípidos enlazados a éster que se encuentran en eubacterias y eucariotas.
