1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gemiola [76]
3 years ago
9

A mother has a blood type a and her son has a blood type o. Which blood types are possible for the father?

Biology
1 answer:
AysviL [449]3 years ago
8 0

Answer:

The Father would have to be either blood Type B or O.

You might be interested in
What team won the first silver medal in Olympic History?<br>​
telo118 [61]
James B. Connolly of Massachusetts was the first modern Olympic champion to be rewarded with a silver medal. He represented the Suffolk Athletic Club
3 0
3 years ago
Light is an example of what in an ecosystem?
BlackZzzverrR [31]


<span>A. abiotic component</span>

An ecosystem involves both the biological (plants, animals, human beings) and non-biological (land, water, soil, and atmosphere) community which interacts as a system. More importantly, the living things are very dependent on the abiotic community since it cannot survive by itself. Every animal, plant and human needs the primary physiological needs of water, food and shelter provided by the abiotic system.   
3 0
4 years ago
Read 2 more answers
On the Pacific island of Guam, large herbivorous bats called "flying foxes" commonly feed on cycad seeds, a potent source of neu
Bad White [126]

Flying foxes disperse the Cycad seeds if  the seed sometimes get swallowed whole.

Explanation:

  • Cycads are gymnosperms they do not have seeds enclosed in fruit. Therefore the bats are not attracted to cycad fruit.
  • If the bats were susceptible to neurotoxin then they must not have been the frequent feeders of cycad seeds. Biomagnification of neurotoxin in flying fox is a widely researched topic.
  • Beetles do not have an association with these bats thus the bats must not be assisting them as important pollinating agents.
7 0
3 years ago
Actin filaments have polarity. This means that the two ends can be identified due to structural differences. The plus end is the
Alenkinab [10]

Answer:

C

Explanation:

Add radio labeled actin sub units to a mixture of actin filaments in which conditions are favorable for polymerization. This would enable you to identify the plus end of actin filaments.

Actin filaments are linear polymer of globular actin sub units Actin filaments have polarity. This means that the two ends can be identified due to structural differences.  

3 0
4 years ago
15. Stephanie made the following chart for the terrestrial planets. What correction needs to be made?
alexandr1967 [171]

Answer:

c. mars has a thin atmosphere

Explanation:

i hope that helps even though its a few days late

4 0
2 years ago
Other questions:
  • Which scientists melted strands of spun glass to create lenses to simulate a microscope? He was the first person to see outlines
    11·1 answer
  • ASAP !!
    11·1 answer
  • A solution that causes water to move out of a cell
    13·1 answer
  • Which statement is true about nitrogen and oxygen?
    6·2 answers
  • Trace fossils like coprolite and gastrolith can tell us what? A) that an organism was once active in an area B) that an organism
    11·2 answers
  • Turkins, a cross between a chicken and a turkey, are raised on some farms in Wyoming. This is an example of _____.
    5·2 answers
  • Which atmospheric layer has the highest air pressure
    11·2 answers
  • How are meiosis and mitosis different?
    7·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Which correctly lists three factors that are important to consider when forecasting weather?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!