1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Valentin [98]
3 years ago
5

17. What is biological adaptation and how is it relevant to life as we know it today?

Biology
2 answers:
Travka [436]3 years ago
8 0

<u>Answer:</u>

Biological adaptation is a concept that involves the action produced by an organisms biological traits and its response to the organisms in the surrounding environment, it is an important trait that is essential today because of the change in climatic conditions and environment day to day is drastic.

Hence an organism with rapid environmental adaptation would be only able to survive. As the saying of Darwin survival of the fittest says the organism that can rapidly adapt to the growing environmental skills will survive.

miss Akunina [59]3 years ago
3 0

Adaptation is when animals inherit certain phenotypes which are coded for by genotypes. A species will have a mutation causing a change in the base sequence. this will lead to a different allele giving a different characteristic which will help them survive. the offspring will inherit this allele hence it'll be passed down each generation.

You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Anyone know about cellular respiration? Please help me label, 60 points!
matrenka [14]

Answer:

Mitochondria- glycolysis

ATP synthase- converts ADP to ATP

Inner membrane- electron transport chain

Matrix- krebs cycle

Explanation:

The mitochondria forms the fundamental site for glycolysis. The glucose is broken down enzymatically to produce carbon dioxide, water and ATP. The krebs cycle is the first stage of aerobic respiration. It takes place in the mitochondrial matrix. ATP synthase is an enzyme that generates ATP during the process of cellular respiration. ATP synthase forms ATP from ADP and an inorganic phosphate (Pi) through oxidative phosphorylation. The mitochondrial inner membrane is the site of the electron transport chain, an important step in aerobic respiration.  Energy obtained through the transfer of electrons down the ETC is used to pump protons from the matrix into the intermembrane space, creating an electrochemical proton gradient generating ATP.

8 0
3 years ago
What do you think determines the success of a population
lawyer [7]

Answer:

cooperation... if no one works together then it's more of a failure than a success

Explanation:

5 0
2 years ago
PLEASE HELP ME! JUST ONE QUESTION! WILL REWARD BRAINLIEST IF TWO PEOPLE ANSWER!!!!!!
mixas84 [53]
The answer is C
hope this helps!!
7 0
2 years ago
When conducting a biology investigation, why is it important to know the safety rules and symbols?
iris [78.8K]
Because if you don’t you may die or get seriously hurt. Or just the investigation will go wrong and get unclear or wrong answers
5 0
3 years ago
Read 2 more answers
Other questions:
  • How many cells does a fungi have?
    14·2 answers
  • Coal makes up what percentage of the fuel used in the United States? 23% 55% 5% 90%
    13·1 answer
  • A centimeter is __ meter(s). 1,000 100 1/100th 1/1,000th
    13·2 answers
  • The larva of a frog is a tadpole.<br><br> true or false
    13·2 answers
  • Plzzz help me
    9·2 answers
  • What holds the base pairs of dna together
    13·1 answer
  • Starting from a single individual, what is the size of a population of bacteria that reproduce by binary fission every 20 minute
    7·1 answer
  • Which of the following is the main idea of paragraph 2? A.Offspring have a combination of traits from their parents. B.Parents h
    5·1 answer
  • A relationship in which one species benefits and the other neither benefits nor is harmed is
    6·2 answers
  • What does pineapple and cranberry juice do for you sexually
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!