1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rzqust [24]
4 years ago
13

Which of the following will most likely have a climate similar to Florida’s?

Biology
1 answer:
konstantin123 [22]4 years ago
7 0
Brazil is hot and humid, so is Florida. So it would be C
You might be interested in
Do environmental or genetic factors affect growth of organisms most?
pav-90 [236]

Answer:

Examples of local environmental conditions could include availability of food, light, space, and water. Examples of genetic factors could include large breed cattle and species of grass affecting growth of organisms. The environment in which an organism lives plays an important role in modifying the rate and extent of growth. Environmental factors may be either physical (e.g., temperature, radiant energy, and atmospheric pressure) or chemical. Organisms and the cells of which they are composed are extremely sensitive to temperature changes; as the temperature decreases, the biochemical reactions necessary for life occur more slowly. A lowering of the temperature by 10° C (18° F) slows metabolism at least twofold and often more.

I copied this stuff from a bunch of different biology websites. It doesn't answer your exact question but I would have to say based on what I typed here it would be the environment that affects the growth of an organism more.

7 0
3 years ago
Why plants need the carbohydrates they produce in photosynthesis?
irakobra [83]

Answer: Carbohydrate make up part of the cellulose, giving plants strength and structure.

Explanation:

3 0
3 years ago
Read 2 more answers
Make a list of countries/states around the world that insects currently do not reside in.
RideAnS [48]

Answer:

Iceland, and states like Washington DC. , South Dakota, Connecticut, Idaho, New Hampshire, Delaware, North Dakota, Illinois.

Explanation:

Iceland is one of the only places where people live without insects.

The reason why Iceland does not have mosquitos or other insects is its oceanic climate that keeps them away.

The insects freeze 3 times a year, which makes their survival in Iceland impossible.

The other states are not completely insect-free, however, their number is so small that is considered as like they don't exist.

7 0
3 years ago
Explain the connection between greenhouse effect, greenhouse gases, use of fossil fuel and global warming.
Ymorist [56]

Greenhouse gases are those thought to contribute to the greenhouse effect, an overall warming of the Earth as atmospheric gases trap electromagnetic radiation from the sun that would otherwise have been reflected back out into space.

Noteworthy greenhouse gases are methane, nitrous oxide, carbon dioxide, hydrofluorocarbons (HFCs), perfluorocarbons (PFCs), and sulfur hexafluoride (SF6). These gases are thought to affect the climate directly and indirectly, even though they constitute only a small fraction of the blanket of gases that make up the atmosphere.

Currently, the composition of the atmosphere is mostly nitrogen and oxygen, with just 0.033 percent carbon dioxide and all other gases accounting for even less.

6 0
3 years ago
Which of the following happens in the G1 Phase of the Cell Cycle?
IgorC [24]

Answer:

DNA REPLICATES

Explanation:

During G1 phase, the cell grows in size and synthesizes mRNA and protein that are required for DNA synthesis. Once the required proteins and growth are complete, the cell enters the next phase of the cell cycle, S phase.

3 0
3 years ago
Read 2 more answers
Other questions:
  • The "primary route of excretion" of drugs from the body is via the
    13·1 answer
  • Why do chloroplast matter in photosynthesis
    15·1 answer
  • 1.produce lead-resistant condors through asexual reproduction
    6·2 answers
  • What are the advantages and disadvantages of Nuclear Energy? Pros versus Cons
    7·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Describe what will happen to the wave as it goes through the hole. what do we call this?​
    9·1 answer
  • A doctor tells her nursing students that it is important to monitor patients' blood pressure when they are receiving verapamil (
    14·2 answers
  • Some areas of the Earth receive more solar radiation than others. Which of the following results from the Sun's uneven heating o
    11·2 answers
  • 4. When and where does anaerobic respiration occur in humans?
    12·1 answer
  • Please help me on this its due tonight ​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!