1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yuki888 [10]
3 years ago
6

¿Cuál es la diferencia entre cromatina y cromosoma?

Biology
1 answer:
xenn [34]3 years ago
6 0
I’m sorry can u translate it to english!
You might be interested in
The genetic material housed inside the cell nucleus is packaged into these organized bundles.
JulsSmile [24]

the genetic material housed inside the cell nucleus is packaged in into these organized bundles.

- chromosomes

5 0
3 years ago
Read 2 more answers
Why compost fertilizer is organic fertilizer​
Elodia [21]

Answer:

Compost fertilizer can only be organic if the products used in the fertilizer are organic.

Explanation:

Meaning it’s made out of organic fruits and veggies.

7 0
3 years ago
Help will mark brainlist
KengaRu [80]

.dont taste or sniff chemical

Tasting and smelling some chemicals can be dangerous and even deadly.the best way to know what is in a container is to label

. Don't play mad scientists

This result in mixing chemcals to see what happens the result could be explosion ,fires,or releasing toxic chemicals

.Dress for the lab

This is a safety rule because clothing is one of your best form of protection against an accident wear covered shoes,long pants,and keep your hair tied so it cant fall into your experiment

8 0
3 years ago
PLZ HELP!!!!
Karolina [17]
<h2><u>Answer:</u></h2><h3><u>Question 1:</u></h3>

The correct option is A (a curved path)

Explanation:

Their way is diverted by the revolution of the earth. This is the Coriolis impact. This is the motivation behind why wind streams on the northern side (north half of the globe) turn counter-clockwise and that blows south of the equator, the southern side of the equator, turn clockwise.

<h3><u>Question 2:</u></h3>

The correct option is B (forms at or near the ground)

Explanation:

Fog is an obvious vaporized comprising of modest water beads or ice precious stones suspended noticeable all around at or close to the Earth's surface.

Haze can be viewed as a sort of low-lying cloud, more often than not taking after stratus, and is vigorously impacted by adjacent waterways, geology, and wind conditions.

5 0
3 years ago
Read 2 more answers
Match the description to the type of muscle.
gregori [183]

Explanation:

Cardiac muscles straited involuntary helps to pump blood through the body.

skeletal straited voluntary helps in body movement.

smooth non straited involuntary helps food to go digestive tract.

3 0
2 years ago
Other questions:
  • According to the theory of plate tectonics, _____.
    13·2 answers
  • Wendy wants to know which colors of light are emitted by her flashlight. Which tool could help her? A. A psychrometer B. A laser
    7·2 answers
  • Which discovery did scientists make when they arranged elements in order of increasing atomic mass?
    5·1 answer
  • In a multi-paragraph essay, explain how the activity of individual neurons enables you to perform a simple action like answering
    14·1 answer
  • The sodium-potassium pump establishes concentration gradients:
    5·1 answer
  • One cat carries heterozygous, long-haired traits (Ss), and its mate carries homozygous short-haired traits (ss). Use a Punnett s
    13·1 answer
  • which off the statement is true The most populous country in the world is: Japan China Russia the United States
    7·1 answer
  • The top layer of the crust is mostly what type of rock?
    15·2 answers
  • This is the process of cleaning something
    15·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!